ID: 1069591601

View in Genome Browser
Species Human (GRCh38)
Location 10:69645398-69645420
Sequence ACCACATCCTAGAAACTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069591601_1069591609 25 Left 1069591601 10:69645398-69645420 CCAGTGAGTTTCTAGGATGTGGT No data
Right 1069591609 10:69645446-69645468 CCTCCTTGGTGCTCAGCCCTGGG No data
1069591601_1069591603 -9 Left 1069591601 10:69645398-69645420 CCAGTGAGTTTCTAGGATGTGGT No data
Right 1069591603 10:69645412-69645434 GGATGTGGTTTCCATGGTGACGG No data
1069591601_1069591605 11 Left 1069591601 10:69645398-69645420 CCAGTGAGTTTCTAGGATGTGGT No data
Right 1069591605 10:69645432-69645454 CGGTACATCTCCTGCCTCCTTGG No data
1069591601_1069591611 28 Left 1069591601 10:69645398-69645420 CCAGTGAGTTTCTAGGATGTGGT No data
Right 1069591611 10:69645449-69645471 CCTTGGTGCTCAGCCCTGGGCGG No data
1069591601_1069591612 29 Left 1069591601 10:69645398-69645420 CCAGTGAGTTTCTAGGATGTGGT No data
Right 1069591612 10:69645450-69645472 CTTGGTGCTCAGCCCTGGGCGGG No data
1069591601_1069591607 24 Left 1069591601 10:69645398-69645420 CCAGTGAGTTTCTAGGATGTGGT No data
Right 1069591607 10:69645445-69645467 GCCTCCTTGGTGCTCAGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069591601 Original CRISPR ACCACATCCTAGAAACTCAC TGG (reversed) Intergenic
No off target data available for this crispr