ID: 1069591604

View in Genome Browser
Species Human (GRCh38)
Location 10:69645423-69645445
Sequence CAGGAGATGTACCGTCACCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069591604_1069591607 -1 Left 1069591604 10:69645423-69645445 CCATGGTGACGGTACATCTCCTG No data
Right 1069591607 10:69645445-69645467 GCCTCCTTGGTGCTCAGCCCTGG No data
1069591604_1069591612 4 Left 1069591604 10:69645423-69645445 CCATGGTGACGGTACATCTCCTG No data
Right 1069591612 10:69645450-69645472 CTTGGTGCTCAGCCCTGGGCGGG No data
1069591604_1069591609 0 Left 1069591604 10:69645423-69645445 CCATGGTGACGGTACATCTCCTG No data
Right 1069591609 10:69645446-69645468 CCTCCTTGGTGCTCAGCCCTGGG No data
1069591604_1069591611 3 Left 1069591604 10:69645423-69645445 CCATGGTGACGGTACATCTCCTG No data
Right 1069591611 10:69645449-69645471 CCTTGGTGCTCAGCCCTGGGCGG No data
1069591604_1069591613 13 Left 1069591604 10:69645423-69645445 CCATGGTGACGGTACATCTCCTG No data
Right 1069591613 10:69645459-69645481 CAGCCCTGGGCGGGTTGCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069591604 Original CRISPR CAGGAGATGTACCGTCACCA TGG (reversed) Intergenic
No off target data available for this crispr