ID: 1069591611

View in Genome Browser
Species Human (GRCh38)
Location 10:69645449-69645471
Sequence CCTTGGTGCTCAGCCCTGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069591601_1069591611 28 Left 1069591601 10:69645398-69645420 CCAGTGAGTTTCTAGGATGTGGT No data
Right 1069591611 10:69645449-69645471 CCTTGGTGCTCAGCCCTGGGCGG No data
1069591604_1069591611 3 Left 1069591604 10:69645423-69645445 CCATGGTGACGGTACATCTCCTG No data
Right 1069591611 10:69645449-69645471 CCTTGGTGCTCAGCCCTGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069591611 Original CRISPR CCTTGGTGCTCAGCCCTGGG CGG Intergenic
No off target data available for this crispr