ID: 1069591938

View in Genome Browser
Species Human (GRCh38)
Location 10:69647574-69647596
Sequence GCATATGCCTACTTTAGGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069591935_1069591938 14 Left 1069591935 10:69647537-69647559 CCACGCAGGCAAAACCTAGGTTC No data
Right 1069591938 10:69647574-69647596 GCATATGCCTACTTTAGGCTAGG No data
1069591936_1069591938 0 Left 1069591936 10:69647551-69647573 CCTAGGTTCTTTGATAGAGAACA No data
Right 1069591938 10:69647574-69647596 GCATATGCCTACTTTAGGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069591938 Original CRISPR GCATATGCCTACTTTAGGCT AGG Intergenic
No off target data available for this crispr