ID: 1069593541

View in Genome Browser
Species Human (GRCh38)
Location 10:69656300-69656322
Sequence ACCATCGGGTTCACGAGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069593541_1069593557 29 Left 1069593541 10:69656300-69656322 CCTGGCCTCGTGAACCCGATGGT No data
Right 1069593557 10:69656352-69656374 TGGAGGTGGGAAGGCCCCCAGGG No data
1069593541_1069593555 20 Left 1069593541 10:69656300-69656322 CCTGGCCTCGTGAACCCGATGGT No data
Right 1069593555 10:69656343-69656365 CCTGGAGTGTGGAGGTGGGAAGG No data
1069593541_1069593556 28 Left 1069593541 10:69656300-69656322 CCTGGCCTCGTGAACCCGATGGT No data
Right 1069593556 10:69656351-69656373 GTGGAGGTGGGAAGGCCCCCAGG No data
1069593541_1069593550 12 Left 1069593541 10:69656300-69656322 CCTGGCCTCGTGAACCCGATGGT No data
Right 1069593550 10:69656335-69656357 CAACTCTCCCTGGAGTGTGGAGG No data
1069593541_1069593549 9 Left 1069593541 10:69656300-69656322 CCTGGCCTCGTGAACCCGATGGT No data
Right 1069593549 10:69656332-69656354 CAACAACTCTCCCTGGAGTGTGG No data
1069593541_1069593545 2 Left 1069593541 10:69656300-69656322 CCTGGCCTCGTGAACCCGATGGT No data
Right 1069593545 10:69656325-69656347 GACCCCTCAACAACTCTCCCTGG No data
1069593541_1069593551 15 Left 1069593541 10:69656300-69656322 CCTGGCCTCGTGAACCCGATGGT No data
Right 1069593551 10:69656338-69656360 CTCTCCCTGGAGTGTGGAGGTGG No data
1069593541_1069593552 16 Left 1069593541 10:69656300-69656322 CCTGGCCTCGTGAACCCGATGGT No data
Right 1069593552 10:69656339-69656361 TCTCCCTGGAGTGTGGAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069593541 Original CRISPR ACCATCGGGTTCACGAGGCC AGG (reversed) Intergenic