ID: 1069594950

View in Genome Browser
Species Human (GRCh38)
Location 10:69664428-69664450
Sequence TGTACCCCATGGGGCCCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069594950_1069594958 -6 Left 1069594950 10:69664428-69664450 CCCACAGGGCCCCATGGGGTACA No data
Right 1069594958 10:69664445-69664467 GGTACACGGGAGAGGAATGCAGG No data
1069594950_1069594963 27 Left 1069594950 10:69664428-69664450 CCCACAGGGCCCCATGGGGTACA No data
Right 1069594963 10:69664478-69664500 TCTGTCTCTCAGATCCCACTGGG No data
1069594950_1069594961 3 Left 1069594950 10:69664428-69664450 CCCACAGGGCCCCATGGGGTACA No data
Right 1069594961 10:69664454-69664476 GAGAGGAATGCAGGCAGGCTGGG No data
1069594950_1069594960 2 Left 1069594950 10:69664428-69664450 CCCACAGGGCCCCATGGGGTACA No data
Right 1069594960 10:69664453-69664475 GGAGAGGAATGCAGGCAGGCTGG No data
1069594950_1069594959 -2 Left 1069594950 10:69664428-69664450 CCCACAGGGCCCCATGGGGTACA No data
Right 1069594959 10:69664449-69664471 CACGGGAGAGGAATGCAGGCAGG No data
1069594950_1069594962 26 Left 1069594950 10:69664428-69664450 CCCACAGGGCCCCATGGGGTACA No data
Right 1069594962 10:69664477-69664499 CTCTGTCTCTCAGATCCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069594950 Original CRISPR TGTACCCCATGGGGCCCTGT GGG (reversed) Intergenic