ID: 1069594958

View in Genome Browser
Species Human (GRCh38)
Location 10:69664445-69664467
Sequence GGTACACGGGAGAGGAATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069594944_1069594958 9 Left 1069594944 10:69664413-69664435 CCTTGACAAGGGTAACCCACAGG No data
Right 1069594958 10:69664445-69664467 GGTACACGGGAGAGGAATGCAGG No data
1069594950_1069594958 -6 Left 1069594950 10:69664428-69664450 CCCACAGGGCCCCATGGGGTACA No data
Right 1069594958 10:69664445-69664467 GGTACACGGGAGAGGAATGCAGG No data
1069594942_1069594958 14 Left 1069594942 10:69664408-69664430 CCCTTCCTTGACAAGGGTAACCC No data
Right 1069594958 10:69664445-69664467 GGTACACGGGAGAGGAATGCAGG No data
1069594939_1069594958 25 Left 1069594939 10:69664397-69664419 CCAAGGGTAAGCCCTTCCTTGAC No data
Right 1069594958 10:69664445-69664467 GGTACACGGGAGAGGAATGCAGG No data
1069594943_1069594958 13 Left 1069594943 10:69664409-69664431 CCTTCCTTGACAAGGGTAACCCA No data
Right 1069594958 10:69664445-69664467 GGTACACGGGAGAGGAATGCAGG No data
1069594951_1069594958 -7 Left 1069594951 10:69664429-69664451 CCACAGGGCCCCATGGGGTACAC No data
Right 1069594958 10:69664445-69664467 GGTACACGGGAGAGGAATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069594958 Original CRISPR GGTACACGGGAGAGGAATGC AGG Intergenic