ID: 1069594960

View in Genome Browser
Species Human (GRCh38)
Location 10:69664453-69664475
Sequence GGAGAGGAATGCAGGCAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069594944_1069594960 17 Left 1069594944 10:69664413-69664435 CCTTGACAAGGGTAACCCACAGG No data
Right 1069594960 10:69664453-69664475 GGAGAGGAATGCAGGCAGGCTGG No data
1069594950_1069594960 2 Left 1069594950 10:69664428-69664450 CCCACAGGGCCCCATGGGGTACA No data
Right 1069594960 10:69664453-69664475 GGAGAGGAATGCAGGCAGGCTGG No data
1069594943_1069594960 21 Left 1069594943 10:69664409-69664431 CCTTCCTTGACAAGGGTAACCCA No data
Right 1069594960 10:69664453-69664475 GGAGAGGAATGCAGGCAGGCTGG No data
1069594957_1069594960 -9 Left 1069594957 10:69664439-69664461 CCATGGGGTACACGGGAGAGGAA No data
Right 1069594960 10:69664453-69664475 GGAGAGGAATGCAGGCAGGCTGG No data
1069594942_1069594960 22 Left 1069594942 10:69664408-69664430 CCCTTCCTTGACAAGGGTAACCC No data
Right 1069594960 10:69664453-69664475 GGAGAGGAATGCAGGCAGGCTGG No data
1069594951_1069594960 1 Left 1069594951 10:69664429-69664451 CCACAGGGCCCCATGGGGTACAC No data
Right 1069594960 10:69664453-69664475 GGAGAGGAATGCAGGCAGGCTGG No data
1069594956_1069594960 -8 Left 1069594956 10:69664438-69664460 CCCATGGGGTACACGGGAGAGGA No data
Right 1069594960 10:69664453-69664475 GGAGAGGAATGCAGGCAGGCTGG No data
1069594954_1069594960 -7 Left 1069594954 10:69664437-69664459 CCCCATGGGGTACACGGGAGAGG No data
Right 1069594960 10:69664453-69664475 GGAGAGGAATGCAGGCAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069594960 Original CRISPR GGAGAGGAATGCAGGCAGGC TGG Intergenic