ID: 1069594963

View in Genome Browser
Species Human (GRCh38)
Location 10:69664478-69664500
Sequence TCTGTCTCTCAGATCCCACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069594950_1069594963 27 Left 1069594950 10:69664428-69664450 CCCACAGGGCCCCATGGGGTACA No data
Right 1069594963 10:69664478-69664500 TCTGTCTCTCAGATCCCACTGGG No data
1069594951_1069594963 26 Left 1069594951 10:69664429-69664451 CCACAGGGCCCCATGGGGTACAC No data
Right 1069594963 10:69664478-69664500 TCTGTCTCTCAGATCCCACTGGG No data
1069594957_1069594963 16 Left 1069594957 10:69664439-69664461 CCATGGGGTACACGGGAGAGGAA No data
Right 1069594963 10:69664478-69664500 TCTGTCTCTCAGATCCCACTGGG No data
1069594954_1069594963 18 Left 1069594954 10:69664437-69664459 CCCCATGGGGTACACGGGAGAGG No data
Right 1069594963 10:69664478-69664500 TCTGTCTCTCAGATCCCACTGGG No data
1069594956_1069594963 17 Left 1069594956 10:69664438-69664460 CCCATGGGGTACACGGGAGAGGA No data
Right 1069594963 10:69664478-69664500 TCTGTCTCTCAGATCCCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069594963 Original CRISPR TCTGTCTCTCAGATCCCACT GGG Intergenic