ID: 1069595263

View in Genome Browser
Species Human (GRCh38)
Location 10:69666084-69666106
Sequence CTGGGGGATCCAGCGGATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069595249_1069595263 19 Left 1069595249 10:69666042-69666064 CCTGGGGCCTCCAGAGGACCCGC No data
Right 1069595263 10:69666084-69666106 CTGGGGGATCCAGCGGATGTGGG No data
1069595246_1069595263 30 Left 1069595246 10:69666031-69666053 CCAGGTGCGACCCTGGGGCCTCC No data
Right 1069595263 10:69666084-69666106 CTGGGGGATCCAGCGGATGTGGG No data
1069595248_1069595263 20 Left 1069595248 10:69666041-69666063 CCCTGGGGCCTCCAGAGGACCCG No data
Right 1069595263 10:69666084-69666106 CTGGGGGATCCAGCGGATGTGGG No data
1069595251_1069595263 12 Left 1069595251 10:69666049-69666071 CCTCCAGAGGACCCGCACCAGGA No data
Right 1069595263 10:69666084-69666106 CTGGGGGATCCAGCGGATGTGGG No data
1069595257_1069595263 -5 Left 1069595257 10:69666066-69666088 CCAGGAGTGCAGCTGAGGCTGGG No data
Right 1069595263 10:69666084-69666106 CTGGGGGATCCAGCGGATGTGGG No data
1069595253_1069595263 1 Left 1069595253 10:69666060-69666082 CCCGCACCAGGAGTGCAGCTGAG No data
Right 1069595263 10:69666084-69666106 CTGGGGGATCCAGCGGATGTGGG No data
1069595252_1069595263 9 Left 1069595252 10:69666052-69666074 CCAGAGGACCCGCACCAGGAGTG No data
Right 1069595263 10:69666084-69666106 CTGGGGGATCCAGCGGATGTGGG No data
1069595254_1069595263 0 Left 1069595254 10:69666061-69666083 CCGCACCAGGAGTGCAGCTGAGG No data
Right 1069595263 10:69666084-69666106 CTGGGGGATCCAGCGGATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069595263 Original CRISPR CTGGGGGATCCAGCGGATGT GGG Intergenic
No off target data available for this crispr