ID: 1069595915

View in Genome Browser
Species Human (GRCh38)
Location 10:69670122-69670144
Sequence AGGGAGAAGGTTGATGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069595915_1069595924 17 Left 1069595915 10:69670122-69670144 CCTGCCTCATCAACCTTCTCCCT No data
Right 1069595924 10:69670162-69670184 TCCCCAGCTTGATCCCTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069595915 Original CRISPR AGGGAGAAGGTTGATGAGGC AGG (reversed) Intergenic
No off target data available for this crispr