ID: 1069597348

View in Genome Browser
Species Human (GRCh38)
Location 10:69681090-69681112
Sequence CTTCCAGGCTGGTCTCCTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069597348_1069597353 -7 Left 1069597348 10:69681090-69681112 CCTCAAGGAGACCAGCCTGGAAG No data
Right 1069597353 10:69681106-69681128 CTGGAAGATGGGACCCCCAGTGG No data
1069597348_1069597362 14 Left 1069597348 10:69681090-69681112 CCTCAAGGAGACCAGCCTGGAAG No data
Right 1069597362 10:69681127-69681149 GGAAAAGGGGCAAGGACCCACGG No data
1069597348_1069597358 6 Left 1069597348 10:69681090-69681112 CCTCAAGGAGACCAGCCTGGAAG No data
Right 1069597358 10:69681119-69681141 CCCCCAGTGGAAAAGGGGCAAGG No data
1069597348_1069597356 1 Left 1069597348 10:69681090-69681112 CCTCAAGGAGACCAGCCTGGAAG No data
Right 1069597356 10:69681114-69681136 TGGGACCCCCAGTGGAAAAGGGG No data
1069597348_1069597363 20 Left 1069597348 10:69681090-69681112 CCTCAAGGAGACCAGCCTGGAAG No data
Right 1069597363 10:69681133-69681155 GGGGCAAGGACCCACGGCCCTGG No data
1069597348_1069597354 -1 Left 1069597348 10:69681090-69681112 CCTCAAGGAGACCAGCCTGGAAG No data
Right 1069597354 10:69681112-69681134 GATGGGACCCCCAGTGGAAAAGG No data
1069597348_1069597355 0 Left 1069597348 10:69681090-69681112 CCTCAAGGAGACCAGCCTGGAAG No data
Right 1069597355 10:69681113-69681135 ATGGGACCCCCAGTGGAAAAGGG No data
1069597348_1069597365 22 Left 1069597348 10:69681090-69681112 CCTCAAGGAGACCAGCCTGGAAG No data
Right 1069597365 10:69681135-69681157 GGCAAGGACCCACGGCCCTGGGG No data
1069597348_1069597364 21 Left 1069597348 10:69681090-69681112 CCTCAAGGAGACCAGCCTGGAAG No data
Right 1069597364 10:69681134-69681156 GGGCAAGGACCCACGGCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069597348 Original CRISPR CTTCCAGGCTGGTCTCCTTG AGG (reversed) Intergenic