ID: 1069598114

View in Genome Browser
Species Human (GRCh38)
Location 10:69685990-69686012
Sequence TTGGGTAGGCCATCGGGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069598107_1069598114 -8 Left 1069598107 10:69685975-69685997 CCCGACCATTTGGGGTTGGGTAG 0: 1
1: 0
2: 0
3: 11
4: 93
Right 1069598114 10:69685990-69686012 TTGGGTAGGCCATCGGGTGTGGG No data
1069598100_1069598114 13 Left 1069598100 10:69685954-69685976 CCAGATTCATCATGACGTCACCC 0: 1
1: 0
2: 0
3: 4
4: 69
Right 1069598114 10:69685990-69686012 TTGGGTAGGCCATCGGGTGTGGG No data
1069598106_1069598114 -7 Left 1069598106 10:69685974-69685996 CCCCGACCATTTGGGGTTGGGTA 0: 1
1: 0
2: 0
3: 3
4: 57
Right 1069598114 10:69685990-69686012 TTGGGTAGGCCATCGGGTGTGGG No data
1069598108_1069598114 -9 Left 1069598108 10:69685976-69685998 CCGACCATTTGGGGTTGGGTAGG 0: 1
1: 0
2: 2
3: 15
4: 106
Right 1069598114 10:69685990-69686012 TTGGGTAGGCCATCGGGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069598114 Original CRISPR TTGGGTAGGCCATCGGGTGT GGG Intronic
No off target data available for this crispr