ID: 1069604331

View in Genome Browser
Species Human (GRCh38)
Location 10:69730307-69730329
Sequence CACTCAAGGCTGGTGGGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069604331_1069604341 3 Left 1069604331 10:69730307-69730329 CCTGTCCCCACCAGCCTTGAGTG No data
Right 1069604341 10:69730333-69730355 CCCTGGCCTGCCTCCCAGTAAGG No data
1069604331_1069604344 11 Left 1069604331 10:69730307-69730329 CCTGTCCCCACCAGCCTTGAGTG No data
Right 1069604344 10:69730341-69730363 TGCCTCCCAGTAAGGTCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069604331 Original CRISPR CACTCAAGGCTGGTGGGGAC AGG (reversed) Intergenic
No off target data available for this crispr