ID: 1069605850

View in Genome Browser
Species Human (GRCh38)
Location 10:69738120-69738142
Sequence CTGTGAAAGTCCAGGTTTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069605842_1069605850 5 Left 1069605842 10:69738092-69738114 CCGCTCATGGGTGAGCCTGGGCC No data
Right 1069605850 10:69738120-69738142 CTGTGAAAGTCCAGGTTTCTGGG No data
1069605833_1069605850 26 Left 1069605833 10:69738071-69738093 CCTGGAGGCCTCTCCTGGGCCCC No data
Right 1069605850 10:69738120-69738142 CTGTGAAAGTCCAGGTTTCTGGG No data
1069605834_1069605850 18 Left 1069605834 10:69738079-69738101 CCTCTCCTGGGCCCCGCTCATGG No data
Right 1069605850 10:69738120-69738142 CTGTGAAAGTCCAGGTTTCTGGG No data
1069605845_1069605850 -10 Left 1069605845 10:69738107-69738129 CCTGGGCCCTGGGCTGTGAAAGT No data
Right 1069605850 10:69738120-69738142 CTGTGAAAGTCCAGGTTTCTGGG No data
1069605841_1069605850 6 Left 1069605841 10:69738091-69738113 CCCGCTCATGGGTGAGCCTGGGC No data
Right 1069605850 10:69738120-69738142 CTGTGAAAGTCCAGGTTTCTGGG No data
1069605837_1069605850 13 Left 1069605837 10:69738084-69738106 CCTGGGCCCCGCTCATGGGTGAG No data
Right 1069605850 10:69738120-69738142 CTGTGAAAGTCCAGGTTTCTGGG No data
1069605839_1069605850 7 Left 1069605839 10:69738090-69738112 CCCCGCTCATGGGTGAGCCTGGG No data
Right 1069605850 10:69738120-69738142 CTGTGAAAGTCCAGGTTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069605850 Original CRISPR CTGTGAAAGTCCAGGTTTCT GGG Intergenic
No off target data available for this crispr