ID: 1069606684

View in Genome Browser
Species Human (GRCh38)
Location 10:69743359-69743381
Sequence CCTCTGCTGTTGGGCCTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069606684_1069606698 17 Left 1069606684 10:69743359-69743381 CCAGCCAGGCCCAACAGCAGAGG No data
Right 1069606698 10:69743399-69743421 TCCTGCAGGAGAGGGCTGGGAGG No data
1069606684_1069606695 9 Left 1069606684 10:69743359-69743381 CCAGCCAGGCCCAACAGCAGAGG No data
Right 1069606695 10:69743391-69743413 GGAGGATTTCCTGCAGGAGAGGG No data
1069606684_1069606692 -9 Left 1069606684 10:69743359-69743381 CCAGCCAGGCCCAACAGCAGAGG No data
Right 1069606692 10:69743373-69743395 CAGCAGAGGGCGACAGTGGGAGG No data
1069606684_1069606694 8 Left 1069606684 10:69743359-69743381 CCAGCCAGGCCCAACAGCAGAGG No data
Right 1069606694 10:69743390-69743412 GGGAGGATTTCCTGCAGGAGAGG No data
1069606684_1069606700 29 Left 1069606684 10:69743359-69743381 CCAGCCAGGCCCAACAGCAGAGG No data
Right 1069606700 10:69743411-69743433 GGGCTGGGAGGCTTCCAACCTGG No data
1069606684_1069606696 13 Left 1069606684 10:69743359-69743381 CCAGCCAGGCCCAACAGCAGAGG No data
Right 1069606696 10:69743395-69743417 GATTTCCTGCAGGAGAGGGCTGG No data
1069606684_1069606697 14 Left 1069606684 10:69743359-69743381 CCAGCCAGGCCCAACAGCAGAGG No data
Right 1069606697 10:69743396-69743418 ATTTCCTGCAGGAGAGGGCTGGG No data
1069606684_1069606693 3 Left 1069606684 10:69743359-69743381 CCAGCCAGGCCCAACAGCAGAGG No data
Right 1069606693 10:69743385-69743407 ACAGTGGGAGGATTTCCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069606684 Original CRISPR CCTCTGCTGTTGGGCCTGGC TGG (reversed) Intergenic
No off target data available for this crispr