ID: 1069606692

View in Genome Browser
Species Human (GRCh38)
Location 10:69743373-69743395
Sequence CAGCAGAGGGCGACAGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069606684_1069606692 -9 Left 1069606684 10:69743359-69743381 CCAGCCAGGCCCAACAGCAGAGG No data
Right 1069606692 10:69743373-69743395 CAGCAGAGGGCGACAGTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069606692 Original CRISPR CAGCAGAGGGCGACAGTGGG AGG Intergenic
No off target data available for this crispr