ID: 1069607944

View in Genome Browser
Species Human (GRCh38)
Location 10:69752013-69752035
Sequence CTGACTGCTGGAAACTGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069607944_1069607952 13 Left 1069607944 10:69752013-69752035 CCTTCTCAGTTTCCAGCAGTCAG No data
Right 1069607952 10:69752049-69752071 TCCTGGGCCGCACCATCCCTTGG No data
1069607944_1069607951 -3 Left 1069607944 10:69752013-69752035 CCTTCTCAGTTTCCAGCAGTCAG No data
Right 1069607951 10:69752033-69752055 CAGAGGACGGGGTGTATCCTGGG No data
1069607944_1069607956 27 Left 1069607944 10:69752013-69752035 CCTTCTCAGTTTCCAGCAGTCAG No data
Right 1069607956 10:69752063-69752085 ATCCCTTGGCTCTGTCTGTGTGG No data
1069607944_1069607950 -4 Left 1069607944 10:69752013-69752035 CCTTCTCAGTTTCCAGCAGTCAG No data
Right 1069607950 10:69752032-69752054 TCAGAGGACGGGGTGTATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069607944 Original CRISPR CTGACTGCTGGAAACTGAGA AGG (reversed) Intergenic
No off target data available for this crispr