ID: 1069607949

View in Genome Browser
Species Human (GRCh38)
Location 10:69752025-69752047
Sequence ACACCCCGTCCTCTGACTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069607949_1069607956 15 Left 1069607949 10:69752025-69752047 CCAGCAGTCAGAGGACGGGGTGT No data
Right 1069607956 10:69752063-69752085 ATCCCTTGGCTCTGTCTGTGTGG No data
1069607949_1069607961 28 Left 1069607949 10:69752025-69752047 CCAGCAGTCAGAGGACGGGGTGT No data
Right 1069607961 10:69752076-69752098 GTCTGTGTGGCGTGTGTGGTGGG No data
1069607949_1069607960 27 Left 1069607949 10:69752025-69752047 CCAGCAGTCAGAGGACGGGGTGT No data
Right 1069607960 10:69752075-69752097 TGTCTGTGTGGCGTGTGTGGTGG No data
1069607949_1069607952 1 Left 1069607949 10:69752025-69752047 CCAGCAGTCAGAGGACGGGGTGT No data
Right 1069607952 10:69752049-69752071 TCCTGGGCCGCACCATCCCTTGG No data
1069607949_1069607959 24 Left 1069607949 10:69752025-69752047 CCAGCAGTCAGAGGACGGGGTGT No data
Right 1069607959 10:69752072-69752094 CTCTGTCTGTGTGGCGTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069607949 Original CRISPR ACACCCCGTCCTCTGACTGC TGG (reversed) Intergenic
No off target data available for this crispr