ID: 1069607951

View in Genome Browser
Species Human (GRCh38)
Location 10:69752033-69752055
Sequence CAGAGGACGGGGTGTATCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069607940_1069607951 16 Left 1069607940 10:69751994-69752016 CCCATCTTTTCCACTTCACCCTT No data
Right 1069607951 10:69752033-69752055 CAGAGGACGGGGTGTATCCTGGG No data
1069607942_1069607951 6 Left 1069607942 10:69752004-69752026 CCACTTCACCCTTCTCAGTTTCC No data
Right 1069607951 10:69752033-69752055 CAGAGGACGGGGTGTATCCTGGG No data
1069607943_1069607951 -2 Left 1069607943 10:69752012-69752034 CCCTTCTCAGTTTCCAGCAGTCA No data
Right 1069607951 10:69752033-69752055 CAGAGGACGGGGTGTATCCTGGG No data
1069607944_1069607951 -3 Left 1069607944 10:69752013-69752035 CCTTCTCAGTTTCCAGCAGTCAG No data
Right 1069607951 10:69752033-69752055 CAGAGGACGGGGTGTATCCTGGG No data
1069607941_1069607951 15 Left 1069607941 10:69751995-69752017 CCATCTTTTCCACTTCACCCTTC No data
Right 1069607951 10:69752033-69752055 CAGAGGACGGGGTGTATCCTGGG No data
1069607939_1069607951 17 Left 1069607939 10:69751993-69752015 CCCCATCTTTTCCACTTCACCCT No data
Right 1069607951 10:69752033-69752055 CAGAGGACGGGGTGTATCCTGGG No data
1069607936_1069607951 28 Left 1069607936 10:69751982-69752004 CCTCCAGTCTCCCCCATCTTTTC No data
Right 1069607951 10:69752033-69752055 CAGAGGACGGGGTGTATCCTGGG No data
1069607938_1069607951 18 Left 1069607938 10:69751992-69752014 CCCCCATCTTTTCCACTTCACCC No data
Right 1069607951 10:69752033-69752055 CAGAGGACGGGGTGTATCCTGGG No data
1069607937_1069607951 25 Left 1069607937 10:69751985-69752007 CCAGTCTCCCCCATCTTTTCCAC No data
Right 1069607951 10:69752033-69752055 CAGAGGACGGGGTGTATCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069607951 Original CRISPR CAGAGGACGGGGTGTATCCT GGG Intergenic
No off target data available for this crispr