ID: 1069607953

View in Genome Browser
Species Human (GRCh38)
Location 10:69752050-69752072
Sequence GCCAAGGGATGGTGCGGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069607953_1069607961 3 Left 1069607953 10:69752050-69752072 CCTGGGCCGCACCATCCCTTGGC No data
Right 1069607961 10:69752076-69752098 GTCTGTGTGGCGTGTGTGGTGGG No data
1069607953_1069607968 25 Left 1069607953 10:69752050-69752072 CCTGGGCCGCACCATCCCTTGGC No data
Right 1069607968 10:69752098-69752120 GTGCAATGGGGGTGGGTTTGTGG No data
1069607953_1069607956 -10 Left 1069607953 10:69752050-69752072 CCTGGGCCGCACCATCCCTTGGC No data
Right 1069607956 10:69752063-69752085 ATCCCTTGGCTCTGTCTGTGTGG No data
1069607953_1069607967 18 Left 1069607953 10:69752050-69752072 CCTGGGCCGCACCATCCCTTGGC No data
Right 1069607967 10:69752091-69752113 GTGGTGGGTGCAATGGGGGTGGG No data
1069607953_1069607962 11 Left 1069607953 10:69752050-69752072 CCTGGGCCGCACCATCCCTTGGC No data
Right 1069607962 10:69752084-69752106 GGCGTGTGTGGTGGGTGCAATGG No data
1069607953_1069607964 13 Left 1069607953 10:69752050-69752072 CCTGGGCCGCACCATCCCTTGGC No data
Right 1069607964 10:69752086-69752108 CGTGTGTGGTGGGTGCAATGGGG No data
1069607953_1069607960 2 Left 1069607953 10:69752050-69752072 CCTGGGCCGCACCATCCCTTGGC No data
Right 1069607960 10:69752075-69752097 TGTCTGTGTGGCGTGTGTGGTGG No data
1069607953_1069607959 -1 Left 1069607953 10:69752050-69752072 CCTGGGCCGCACCATCCCTTGGC No data
Right 1069607959 10:69752072-69752094 CTCTGTCTGTGTGGCGTGTGTGG No data
1069607953_1069607963 12 Left 1069607953 10:69752050-69752072 CCTGGGCCGCACCATCCCTTGGC No data
Right 1069607963 10:69752085-69752107 GCGTGTGTGGTGGGTGCAATGGG No data
1069607953_1069607966 17 Left 1069607953 10:69752050-69752072 CCTGGGCCGCACCATCCCTTGGC No data
Right 1069607966 10:69752090-69752112 TGTGGTGGGTGCAATGGGGGTGG No data
1069607953_1069607965 14 Left 1069607953 10:69752050-69752072 CCTGGGCCGCACCATCCCTTGGC No data
Right 1069607965 10:69752087-69752109 GTGTGTGGTGGGTGCAATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069607953 Original CRISPR GCCAAGGGATGGTGCGGCCC AGG (reversed) Intergenic
No off target data available for this crispr