ID: 1069607956

View in Genome Browser
Species Human (GRCh38)
Location 10:69752063-69752085
Sequence ATCCCTTGGCTCTGTCTGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069607943_1069607956 28 Left 1069607943 10:69752012-69752034 CCCTTCTCAGTTTCCAGCAGTCA No data
Right 1069607956 10:69752063-69752085 ATCCCTTGGCTCTGTCTGTGTGG No data
1069607944_1069607956 27 Left 1069607944 10:69752013-69752035 CCTTCTCAGTTTCCAGCAGTCAG No data
Right 1069607956 10:69752063-69752085 ATCCCTTGGCTCTGTCTGTGTGG No data
1069607953_1069607956 -10 Left 1069607953 10:69752050-69752072 CCTGGGCCGCACCATCCCTTGGC No data
Right 1069607956 10:69752063-69752085 ATCCCTTGGCTCTGTCTGTGTGG No data
1069607949_1069607956 15 Left 1069607949 10:69752025-69752047 CCAGCAGTCAGAGGACGGGGTGT No data
Right 1069607956 10:69752063-69752085 ATCCCTTGGCTCTGTCTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069607956 Original CRISPR ATCCCTTGGCTCTGTCTGTG TGG Intergenic
No off target data available for this crispr