ID: 1069607958

View in Genome Browser
Species Human (GRCh38)
Location 10:69752066-69752088
Sequence ACGCCACACAGACAGAGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069607958_1069607962 -5 Left 1069607958 10:69752066-69752088 CCTTGGCTCTGTCTGTGTGGCGT No data
Right 1069607962 10:69752084-69752106 GGCGTGTGTGGTGGGTGCAATGG No data
1069607958_1069607965 -2 Left 1069607958 10:69752066-69752088 CCTTGGCTCTGTCTGTGTGGCGT No data
Right 1069607965 10:69752087-69752109 GTGTGTGGTGGGTGCAATGGGGG No data
1069607958_1069607968 9 Left 1069607958 10:69752066-69752088 CCTTGGCTCTGTCTGTGTGGCGT No data
Right 1069607968 10:69752098-69752120 GTGCAATGGGGGTGGGTTTGTGG No data
1069607958_1069607963 -4 Left 1069607958 10:69752066-69752088 CCTTGGCTCTGTCTGTGTGGCGT No data
Right 1069607963 10:69752085-69752107 GCGTGTGTGGTGGGTGCAATGGG No data
1069607958_1069607969 18 Left 1069607958 10:69752066-69752088 CCTTGGCTCTGTCTGTGTGGCGT No data
Right 1069607969 10:69752107-69752129 GGGTGGGTTTGTGGCTCATGAGG No data
1069607958_1069607966 1 Left 1069607958 10:69752066-69752088 CCTTGGCTCTGTCTGTGTGGCGT No data
Right 1069607966 10:69752090-69752112 TGTGGTGGGTGCAATGGGGGTGG No data
1069607958_1069607967 2 Left 1069607958 10:69752066-69752088 CCTTGGCTCTGTCTGTGTGGCGT No data
Right 1069607967 10:69752091-69752113 GTGGTGGGTGCAATGGGGGTGGG No data
1069607958_1069607964 -3 Left 1069607958 10:69752066-69752088 CCTTGGCTCTGTCTGTGTGGCGT No data
Right 1069607964 10:69752086-69752108 CGTGTGTGGTGGGTGCAATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069607958 Original CRISPR ACGCCACACAGACAGAGCCA AGG (reversed) Intergenic
No off target data available for this crispr