ID: 1069607961

View in Genome Browser
Species Human (GRCh38)
Location 10:69752076-69752098
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069607949_1069607961 28 Left 1069607949 10:69752025-69752047 CCAGCAGTCAGAGGACGGGGTGT No data
Right 1069607961 10:69752076-69752098 GTCTGTGTGGCGTGTGTGGTGGG No data
1069607953_1069607961 3 Left 1069607953 10:69752050-69752072 CCTGGGCCGCACCATCCCTTGGC No data
Right 1069607961 10:69752076-69752098 GTCTGTGTGGCGTGTGTGGTGGG No data
1069607955_1069607961 -8 Left 1069607955 10:69752061-69752083 CCATCCCTTGGCTCTGTCTGTGT No data
Right 1069607961 10:69752076-69752098 GTCTGTGTGGCGTGTGTGGTGGG No data
1069607954_1069607961 -3 Left 1069607954 10:69752056-69752078 CCGCACCATCCCTTGGCTCTGTC No data
Right 1069607961 10:69752076-69752098 GTCTGTGTGGCGTGTGTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069607961 Original CRISPR GTCTGTGTGGCGTGTGTGGT GGG Intergenic
No off target data available for this crispr