ID: 1069607964

View in Genome Browser
Species Human (GRCh38)
Location 10:69752086-69752108
Sequence CGTGTGTGGTGGGTGCAATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069607957_1069607964 -2 Left 1069607957 10:69752065-69752087 CCCTTGGCTCTGTCTGTGTGGCG No data
Right 1069607964 10:69752086-69752108 CGTGTGTGGTGGGTGCAATGGGG No data
1069607954_1069607964 7 Left 1069607954 10:69752056-69752078 CCGCACCATCCCTTGGCTCTGTC No data
Right 1069607964 10:69752086-69752108 CGTGTGTGGTGGGTGCAATGGGG No data
1069607953_1069607964 13 Left 1069607953 10:69752050-69752072 CCTGGGCCGCACCATCCCTTGGC No data
Right 1069607964 10:69752086-69752108 CGTGTGTGGTGGGTGCAATGGGG No data
1069607955_1069607964 2 Left 1069607955 10:69752061-69752083 CCATCCCTTGGCTCTGTCTGTGT No data
Right 1069607964 10:69752086-69752108 CGTGTGTGGTGGGTGCAATGGGG No data
1069607958_1069607964 -3 Left 1069607958 10:69752066-69752088 CCTTGGCTCTGTCTGTGTGGCGT No data
Right 1069607964 10:69752086-69752108 CGTGTGTGGTGGGTGCAATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069607964 Original CRISPR CGTGTGTGGTGGGTGCAATG GGG Intergenic
No off target data available for this crispr