ID: 1069608435

View in Genome Browser
Species Human (GRCh38)
Location 10:69756011-69756033
Sequence GGGGCTTGGAAGTCAAAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069608424_1069608435 30 Left 1069608424 10:69755958-69755980 CCACATACACATACTCCATCCTA No data
Right 1069608435 10:69756011-69756033 GGGGCTTGGAAGTCAAAAGCAGG No data
1069608428_1069608435 6 Left 1069608428 10:69755982-69756004 CCCAAGAGAGAAGAGCCGAGTCA No data
Right 1069608435 10:69756011-69756033 GGGGCTTGGAAGTCAAAAGCAGG No data
1069608425_1069608435 15 Left 1069608425 10:69755973-69755995 CCATCCTACCCCAAGAGAGAAGA No data
Right 1069608435 10:69756011-69756033 GGGGCTTGGAAGTCAAAAGCAGG No data
1069608427_1069608435 7 Left 1069608427 10:69755981-69756003 CCCCAAGAGAGAAGAGCCGAGTC No data
Right 1069608435 10:69756011-69756033 GGGGCTTGGAAGTCAAAAGCAGG No data
1069608433_1069608435 -9 Left 1069608433 10:69755997-69756019 CCGAGTCATATGATGGGGCTTGG No data
Right 1069608435 10:69756011-69756033 GGGGCTTGGAAGTCAAAAGCAGG No data
1069608426_1069608435 11 Left 1069608426 10:69755977-69755999 CCTACCCCAAGAGAGAAGAGCCG No data
Right 1069608435 10:69756011-69756033 GGGGCTTGGAAGTCAAAAGCAGG No data
1069608429_1069608435 5 Left 1069608429 10:69755983-69756005 CCAAGAGAGAAGAGCCGAGTCAT No data
Right 1069608435 10:69756011-69756033 GGGGCTTGGAAGTCAAAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069608435 Original CRISPR GGGGCTTGGAAGTCAAAAGC AGG Intergenic
No off target data available for this crispr