ID: 1069610286

View in Genome Browser
Species Human (GRCh38)
Location 10:69768232-69768254
Sequence GACTCAGTTCTGCCTTCGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069610286_1069610289 1 Left 1069610286 10:69768232-69768254 CCCAACGAAGGCAGAACTGAGTC No data
Right 1069610289 10:69768256-69768278 CTCTCCTCTTCTTCAGGCAAAGG No data
1069610286_1069610295 14 Left 1069610286 10:69768232-69768254 CCCAACGAAGGCAGAACTGAGTC No data
Right 1069610295 10:69768269-69768291 CAGGCAAAGGCTGGGGGCTGAGG No data
1069610286_1069610299 28 Left 1069610286 10:69768232-69768254 CCCAACGAAGGCAGAACTGAGTC No data
Right 1069610299 10:69768283-69768305 GGGCTGAGGGCTCTGGCCTCGGG No data
1069610286_1069610296 15 Left 1069610286 10:69768232-69768254 CCCAACGAAGGCAGAACTGAGTC No data
Right 1069610296 10:69768270-69768292 AGGCAAAGGCTGGGGGCTGAGGG No data
1069610286_1069610298 27 Left 1069610286 10:69768232-69768254 CCCAACGAAGGCAGAACTGAGTC No data
Right 1069610298 10:69768282-69768304 GGGGCTGAGGGCTCTGGCCTCGG No data
1069610286_1069610292 6 Left 1069610286 10:69768232-69768254 CCCAACGAAGGCAGAACTGAGTC No data
Right 1069610292 10:69768261-69768283 CTCTTCTTCAGGCAAAGGCTGGG No data
1069610286_1069610291 5 Left 1069610286 10:69768232-69768254 CCCAACGAAGGCAGAACTGAGTC No data
Right 1069610291 10:69768260-69768282 CCTCTTCTTCAGGCAAAGGCTGG No data
1069610286_1069610293 7 Left 1069610286 10:69768232-69768254 CCCAACGAAGGCAGAACTGAGTC No data
Right 1069610293 10:69768262-69768284 TCTTCTTCAGGCAAAGGCTGGGG No data
1069610286_1069610288 -5 Left 1069610286 10:69768232-69768254 CCCAACGAAGGCAGAACTGAGTC No data
Right 1069610288 10:69768250-69768272 GAGTCACTCTCCTCTTCTTCAGG No data
1069610286_1069610294 8 Left 1069610286 10:69768232-69768254 CCCAACGAAGGCAGAACTGAGTC No data
Right 1069610294 10:69768263-69768285 CTTCTTCAGGCAAAGGCTGGGGG No data
1069610286_1069610297 21 Left 1069610286 10:69768232-69768254 CCCAACGAAGGCAGAACTGAGTC No data
Right 1069610297 10:69768276-69768298 AGGCTGGGGGCTGAGGGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069610286 Original CRISPR GACTCAGTTCTGCCTTCGTT GGG (reversed) Intergenic
No off target data available for this crispr