ID: 1069610493

View in Genome Browser
Species Human (GRCh38)
Location 10:69769431-69769453
Sequence CAGCTGTTTTGGGGGCTCCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069610493_1069610504 12 Left 1069610493 10:69769431-69769453 CCGCGGAGCCCCCAAAACAGCTG No data
Right 1069610504 10:69769466-69769488 CAGATGTACTACCAGAAGGAAGG No data
1069610493_1069610506 23 Left 1069610493 10:69769431-69769453 CCGCGGAGCCCCCAAAACAGCTG No data
Right 1069610506 10:69769477-69769499 CCAGAAGGAAGGTCCAAGAGAGG No data
1069610493_1069610502 8 Left 1069610493 10:69769431-69769453 CCGCGGAGCCCCCAAAACAGCTG No data
Right 1069610502 10:69769462-69769484 GGTCCAGATGTACTACCAGAAGG No data
1069610493_1069610507 30 Left 1069610493 10:69769431-69769453 CCGCGGAGCCCCCAAAACAGCTG No data
Right 1069610507 10:69769484-69769506 GAAGGTCCAAGAGAGGCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069610493 Original CRISPR CAGCTGTTTTGGGGGCTCCG CGG (reversed) Intergenic
No off target data available for this crispr