ID: 1069616387

View in Genome Browser
Species Human (GRCh38)
Location 10:69809019-69809041
Sequence CCTTGGGAGTAGAGGATGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 895
Summary {0: 1, 1: 0, 2: 3, 3: 69, 4: 822}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069616387_1069616397 18 Left 1069616387 10:69809019-69809041 CCTCCCATCCTCTACTCCCAAGG 0: 1
1: 0
2: 3
3: 69
4: 822
Right 1069616397 10:69809060-69809082 CCTGCCCCAGCTGGCTGCCAAGG No data
1069616387_1069616395 9 Left 1069616387 10:69809019-69809041 CCTCCCATCCTCTACTCCCAAGG 0: 1
1: 0
2: 3
3: 69
4: 822
Right 1069616395 10:69809051-69809073 TCATTTTTACCTGCCCCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069616387 Original CRISPR CCTTGGGAGTAGAGGATGGG AGG (reversed) Intronic
900365775 1:2311394-2311416 TCTGGGGGGCAGAGGATGGGCGG + Intergenic
900457627 1:2785207-2785229 GCTTGGGAGAGGAGGATGAGGGG + Intronic
901942994 1:12678148-12678170 ACTTGAGTGTAAAGGATGGGAGG + Intergenic
902868005 1:19293608-19293630 CTTTGGGAGGACAAGATGGGCGG + Intergenic
903054464 1:20625954-20625976 CCTTGGAAGAAAAGGAAGGGAGG + Intergenic
903204327 1:21769378-21769400 ACTTGGGGGTGGAGGGTGGGAGG + Intronic
903366327 1:22807545-22807567 CCATGGGGGTAGAGGCTGGGAGG - Intronic
903499342 1:23792925-23792947 CCTTGGGGGTGGGGGAGGGGTGG + Intronic
903928285 1:26847453-26847475 CCTTGGGAGGCCAAGATGGGAGG - Intronic
904134034 1:28297160-28297182 CCTTTGGAATAGAGGTTAGGAGG + Intergenic
904287718 1:29462727-29462749 CCTTGTGAGTAGTGGGTAGGAGG + Intergenic
904575415 1:31502172-31502194 CCTTGGGAGAAGAGGATGCCAGG - Intergenic
905267490 1:36764872-36764894 CCTTGGCTGAAGAGGGTGGGTGG - Intergenic
905430305 1:37917684-37917706 CTTTGGGAGTTCACGATGGGAGG + Intronic
906190294 1:43894578-43894600 TGTTGAGAGTAGAGGAAGGGTGG - Intronic
906199992 1:43953760-43953782 CCTTGGGAGTTGGGGATGGAGGG + Intronic
906545739 1:46618027-46618049 GCTTGGGAGTGGAGGGCGGGAGG + Intergenic
906642295 1:47448826-47448848 TATTGGGAGTAGAGAAGGGGAGG + Intergenic
906997545 1:50813062-50813084 CCTTGAGAGTGGCGGGTGGGAGG + Intronic
909568616 1:77083371-77083393 ACTTGGGGGTGGAGGGTGGGAGG - Intergenic
910592239 1:88938530-88938552 CCTTGAGGGTGGAGGGTGGGAGG - Intronic
910806462 1:91193555-91193577 CCTGGGGGGTAGAGGAGGGGTGG - Intergenic
911040332 1:93586183-93586205 GGTGGGGAGTAGGGGATGGGAGG - Intronic
911535190 1:99091055-99091077 ACTTGAGGGTGGAGGATGGGAGG - Intergenic
911880508 1:103232640-103232662 CTTTGGGAGTCCAAGATGGGAGG + Intergenic
912188992 1:107315633-107315655 CCTTGGGACTCAAGGCTGGGAGG - Intronic
912326079 1:108764031-108764053 ACTTGAGGGTAGAGGGTGGGAGG - Intronic
912538287 1:110392637-110392659 CTTTGGGAGGTCAGGATGGGAGG - Intergenic
913253902 1:116937172-116937194 CCTTGGGAGCAGAGCATGGCTGG + Intronic
914220328 1:145675771-145675793 CTTTGGGAGTACAAGGTGGGCGG + Intronic
914472907 1:147998634-147998656 CTTTGGGAGTACAAGGTGGGCGG + Intergenic
915334100 1:155130456-155130478 CCTTGGGAGGAGGGGAGAGGAGG + Intronic
915866494 1:159505143-159505165 CTTTGGGAGTCCAGGATGGGTGG - Intergenic
916047690 1:161013082-161013104 ACTTGAGTTTAGAGGATGGGAGG - Intronic
916062165 1:161107051-161107073 CTTTGGGAGGCTAGGATGGGAGG - Intronic
916708373 1:167377815-167377837 ACTTGAGGGTAGAGGGTGGGAGG - Intronic
916789618 1:168113821-168113843 ACTTGAGAGTGGAGGGTGGGAGG + Intronic
916940642 1:169673651-169673673 ACTTGAGAATAGAGGGTGGGAGG + Intronic
917071006 1:171150776-171150798 GCTTGACAGTAGAGGGTGGGAGG + Intronic
917313635 1:173702967-173702989 CTTTGGGAGTCCAGGTTGGGAGG - Intergenic
917585216 1:176419270-176419292 ACTTGAGGGTAGAGGGTGGGAGG - Intergenic
917697424 1:177540391-177540413 ACTTGAGAGTGCAGGATGGGAGG + Intergenic
917955368 1:180091114-180091136 ACTTGGGAGGCTAGGATGGGAGG - Intronic
918113947 1:181481885-181481907 ATTTGGGAGTAAAGGATGGGGGG + Intronic
918550705 1:185739016-185739038 ACTTGAGATTAGAGGATAGGGGG - Intronic
919134272 1:193488835-193488857 CTTTGGGGGTAGAAGCTGGGAGG - Intergenic
919376989 1:196807479-196807501 ACTTGAGGGTGGAGGATGGGAGG + Intergenic
919386691 1:196932364-196932386 ACTTGAGGGTGGAGGATGGGAGG + Intronic
919389534 1:196964828-196964850 TCTTGAGGGTGGAGGATGGGAGG + Intergenic
920075384 1:203332624-203332646 CCTTGGGAGGTCAAGATGGGAGG + Intergenic
920327747 1:205179877-205179899 CCTTCTGAGTAGAGGATGGATGG - Intronic
920718734 1:208367225-208367247 CCTGGGGAGTAGGGCAGGGGAGG + Intergenic
920740458 1:208576973-208576995 AGTTGGGGGTTGAGGATGGGTGG - Intergenic
920892865 1:210009814-210009836 CATTTGGATTAGAGCATGGGAGG - Intronic
921272490 1:213485107-213485129 CTTTGGGAGGCCAGGATGGGAGG - Intergenic
921864865 1:220077931-220077953 CCTTGGGAGTCTAAGGTGGGTGG + Intronic
923017509 1:230138279-230138301 CCTTGGGAGGCCAAGATGGGCGG + Intronic
923383537 1:233444868-233444890 GCTTGAGAGAAGAGGGTGGGAGG + Intergenic
923532296 1:234821029-234821051 CCCTGGGAGGGGAGGATGGTGGG - Intergenic
924044149 1:240010859-240010881 GCTTGCAAGTAGAGGAGGGGAGG - Intergenic
924128966 1:240885742-240885764 ACTTGAGAGTGGAGGGTGGGAGG + Intronic
924269349 1:242316760-242316782 GCTTGAGAGTGGAGGGTGGGAGG - Intronic
924463204 1:244277689-244277711 CCTTGAGAGTGGAGGGTGGGAGG - Intergenic
924559555 1:245146472-245146494 AATTGAGGGTAGAGGATGGGAGG - Intergenic
924587469 1:245372514-245372536 ACTTGGGGGTGGAGGGTGGGAGG - Intronic
924857300 1:247886638-247886660 CTTTGGGAGTCCAAGATGGGTGG + Intergenic
1063269963 10:4497296-4497318 ACTTGAGGGTAGAGGGTGGGAGG - Intergenic
1063448040 10:6132458-6132480 CCTTGAGGGTGGAGGGTGGGAGG + Intergenic
1064102363 10:12474743-12474765 GCTTGAGGGTAGAGGGTGGGAGG - Intronic
1064104151 10:12487165-12487187 CCTTCAGGGTGGAGGATGGGAGG - Intronic
1064366573 10:14714024-14714046 ACTTGAGAGTGGAGGGTGGGAGG + Intronic
1064437108 10:15320121-15320143 ACTTGAGAGTGGAGGGTGGGAGG - Intronic
1064446766 10:15400835-15400857 ACTTGAGAATAAAGGATGGGAGG + Intergenic
1064525759 10:16254912-16254934 ACTTGAGAGTGGAGGGTGGGAGG + Intergenic
1064534392 10:16343841-16343863 CCTGGGGAGGATGGGATGGGAGG - Intergenic
1064685863 10:17860519-17860541 CTTTGGGAGTCGAAGTTGGGAGG - Intronic
1064748631 10:18502802-18502824 ACTTGAGGGTGGAGGATGGGAGG + Intronic
1064843254 10:19620313-19620335 ACTTGAGAGTGGAGGGTGGGAGG - Intronic
1064928246 10:20593951-20593973 TCTTGGGGGTAGAGGTTGAGAGG - Intergenic
1064990980 10:21256585-21256607 CTTTGGGAGGCTAGGATGGGAGG + Intergenic
1065244130 10:23740601-23740623 CCTTGGGAGGCCAAGATGGGAGG - Intronic
1065689353 10:28317282-28317304 CTTTGGGAGGCCAGGATGGGAGG + Intronic
1065706792 10:28477927-28477949 CTTTGGGAGAACAAGATGGGAGG + Intergenic
1065860417 10:29867876-29867898 ACTTGAGGGTAGAGGATGGGAGG - Intergenic
1065912407 10:30320282-30320304 CTTTGGGAGAACAAGATGGGAGG + Intronic
1066467997 10:35670349-35670371 GCTGGGGAGTAGAGAGTGGGAGG + Intergenic
1066715552 10:38282007-38282029 ACTTGAGAGTGGAGGGTGGGAGG + Intergenic
1067032745 10:42889277-42889299 ACTGGGGAGTGGAGGAGGGGTGG + Intergenic
1067189752 10:44059402-44059424 CCCAGGGAGTTCAGGATGGGTGG + Intergenic
1067945292 10:50685112-50685134 CCTGGGGAGGAGAGGTTGGCCGG - Intergenic
1068541845 10:58303658-58303680 CTGTGGGGGTAGGGGATGGGGGG + Intergenic
1069000203 10:63254647-63254669 ACTTGGGAGGCGGGGATGGGAGG - Intronic
1069011697 10:63381260-63381282 CTTTGGGAGGAGGAGATGGGAGG + Intronic
1069277421 10:66610094-66610116 GCTGAAGAGTAGAGGATGGGAGG + Intronic
1069466551 10:68644447-68644469 CTTTGGGAGGACAAGATGGGAGG - Intronic
1069522940 10:69140315-69140337 CTTTGGGAGGCCAGGATGGGAGG - Intronic
1069557995 10:69410271-69410293 CTTTGGGAGACCAGGATGGGAGG + Intronic
1069614988 10:69801403-69801425 GCTTGGGAGTAGAGGAGCGGTGG + Intergenic
1069616387 10:69809019-69809041 CCTTGGGAGTAGAGGATGGGAGG - Intronic
1069688384 10:70333904-70333926 CTTTGGGAGGACATGATGGGTGG + Intronic
1070259903 10:74844971-74844993 CCTTGGGAGGCCAGGGTGGGAGG + Intronic
1070377031 10:75842782-75842804 CTTTGGGAGGCCAGGATGGGAGG + Intronic
1070379070 10:75863398-75863420 CCTTTGGAGTAGAGAATTTGGGG + Intronic
1070602434 10:77875393-77875415 CCCAGGGAATAGAGGCTGGGGGG - Intronic
1070880592 10:79850105-79850127 CCTGGGGAGGAGAGGTTGGCCGG - Exonic
1071633714 10:87234207-87234229 CCTGGGGAGGAGAGGTTGGCCGG - Exonic
1071647162 10:87366423-87366445 CCTGGGGAGGAGAGGTTGGCCGG - Exonic
1071734578 10:88283804-88283826 ACCTGAGAGTAGAGGGTGGGAGG + Intronic
1072284115 10:93896237-93896259 CCTTGGGAGGACAAGGTGGGAGG - Intronic
1072919807 10:99567045-99567067 CTTTGGGAGGACATGATGGGAGG - Intergenic
1073197821 10:101708426-101708448 CCTAGGGATTAGAGGAGGAGAGG + Intergenic
1073222066 10:101883169-101883191 CTTTGGGAGGACAAGATGGGAGG + Intronic
1073297776 10:102451275-102451297 CCTTGGGACAAGAGGCTAGGCGG - Intronic
1073321236 10:102617479-102617501 CCAAGGGAGAAGAGGAGGGGTGG - Intronic
1073564727 10:104525405-104525427 CCTTGAGAGCAGAGGATGAGGGG - Intergenic
1073737315 10:106364210-106364232 CCTTGGGAGTCCAAGTTGGGAGG + Intergenic
1073863731 10:107776544-107776566 ACTTGAGGGTAGAGGATGGGAGG + Intergenic
1073880869 10:107978219-107978241 CCTTGGGGGTGAAGGATTGGAGG + Intergenic
1074056815 10:109929727-109929749 CCTAGGGTGGAGAGGACGGGGGG - Intergenic
1074324297 10:112433048-112433070 AATTGGGACTAGAGGTTGGGAGG - Intronic
1074393656 10:113079075-113079097 CTTTGGGAGGCCAGGATGGGTGG - Intronic
1074959653 10:118430560-118430582 ACTTGAGAGTGGAGGGTGGGAGG + Intergenic
1075188099 10:120281583-120281605 ACTTGAGAGTGGAGGATGTGGGG + Intergenic
1075367985 10:121909801-121909823 CTTTGGGAGGCGAGGGTGGGAGG + Intronic
1075692986 10:124412560-124412582 CCTTGGGAGGCCAAGATGGGAGG + Intronic
1075794185 10:125107146-125107168 CCTTCGGAGTAGGGGAGGAGGGG - Intronic
1075833094 10:125427946-125427968 CCATGGGTGTAAAGGGTGGGGGG - Intergenic
1076324553 10:129611092-129611114 CCTAGGGAGTAGAGGAGGCCTGG + Intronic
1076417685 10:130303110-130303132 CCTTGGGAGGCGAAGGTGGGAGG - Intergenic
1076770993 10:132664771-132664793 CCTTGGGACAGAAGGATGGGTGG - Intronic
1077095100 11:795825-795847 CCTTGGGGGTGGGGGATGGCTGG + Intronic
1077127235 11:946203-946225 GCTGGGGAGAAGAGAATGGGAGG - Intronic
1077528339 11:3082538-3082560 ACTTGAGAGTGGAGGGTGGGAGG - Intergenic
1077529017 11:3086517-3086539 CCTTGGGGGTCGAGGTGGGGAGG + Intergenic
1077585339 11:3447328-3447350 CCTTGGGGATAAAGGAGGGGAGG + Intergenic
1078133182 11:8630308-8630330 CCTGGGGTCTAGAGGGTGGGTGG - Intronic
1078263721 11:9736963-9736985 CTTTGGGAGGACAGGGTGGGAGG + Intronic
1078541141 11:12213949-12213971 CCATGGGCCTAGAGGATAGGAGG + Intronic
1078627429 11:12970454-12970476 ACTTGAGAGTGGAGGATGGAAGG + Intergenic
1078715246 11:13833509-13833531 ACATGAGGGTAGAGGATGGGAGG - Intergenic
1079837814 11:25356042-25356064 ACTTGGGAGGATAAGATGGGAGG + Intergenic
1079870260 11:25789752-25789774 TCTTGGAAGTTGAGGATGGATGG - Intergenic
1079880002 11:25915107-25915129 ACTTGGGGGTGGTGGATGGGAGG + Intergenic
1080381460 11:31776040-31776062 GTTTGGGAGGAGAAGATGGGAGG + Intronic
1080398629 11:31913524-31913546 CCTTGAGGGTGGAGGGTGGGAGG - Intronic
1080485118 11:32697951-32697973 ACTTGAGCGTGGAGGATGGGAGG - Intronic
1080812112 11:35715195-35715217 CCCTGGGAGGAGAGGATGCTTGG + Intronic
1080838116 11:35959308-35959330 GATTGGGAGTTGAAGATGGGAGG - Intronic
1081443543 11:43107054-43107076 ACTTGAGCGTGGAGGATGGGAGG - Intergenic
1081550443 11:44106870-44106892 CCTTGGGAGGCCAAGATGGGTGG - Intronic
1082038492 11:47665288-47665310 CTTTGGGAGGACAAGATGGGTGG - Intronic
1082246788 11:49932622-49932644 TCTTGGGAGTAGGGTATGGCTGG - Intergenic
1082702718 11:56453089-56453111 CCTTGAGAATGGAGGGTGGGAGG + Intergenic
1082836402 11:57653995-57654017 CCTTGGGAGGCCAGGGTGGGTGG - Intronic
1083114751 11:60449764-60449786 ACTTGAGGGTGGAGGATGGGAGG + Intronic
1083485276 11:62979626-62979648 GCTTGGGAGTGGAGGCTAGGAGG + Intronic
1083851223 11:65368452-65368474 CTTTGGGAGGCCAGGATGGGAGG - Intergenic
1084065922 11:66704545-66704567 CCTTGGGAGGTGGGGGTGGGGGG - Intronic
1084178802 11:67436639-67436661 CCGGGGGAGGGGAGGATGGGAGG - Intronic
1084763913 11:71295058-71295080 GCCTGGGATTGGAGGATGGGTGG + Intergenic
1084782829 11:71422228-71422250 CCTTGAGGGTGGAGGACGGGAGG + Intergenic
1084967694 11:72752906-72752928 CCTTGGGAGGTGTGGCTGGGTGG - Intronic
1085226286 11:74924083-74924105 CTTTGGGAGGCCAGGATGGGAGG - Intronic
1085290519 11:75395991-75396013 ACATGGGATTATAGGATGGGCGG + Intergenic
1086664192 11:89459292-89459314 ACTTGAGGGTAGAGGGTGGGAGG + Intronic
1086754483 11:90542609-90542631 CTTTGGGAGGACAAGATGGGAGG + Intergenic
1087414744 11:97839874-97839896 TTTTGAGAGTGGAGGATGGGAGG + Intergenic
1087978090 11:104575404-104575426 ACTTGAGGGTAGAGGGTGGGAGG + Intergenic
1089028287 11:115294789-115294811 CCTTGGGAGGAGGAGGTGGGTGG + Intronic
1089033189 11:115355460-115355482 ACTTGAGGGTAGAGGCTGGGAGG + Intronic
1089226718 11:116930251-116930273 CAATGGGAGTAGGGGTTGGGGGG - Intronic
1089258258 11:117205565-117205587 ACTTCGGGGTAGAGGCTGGGAGG - Exonic
1089288397 11:117422281-117422303 CCTTGTGAGTAGAAGTTGGAGGG + Intergenic
1089481414 11:118808156-118808178 ACTTGAGAGTGGAGGGTGGGAGG + Intergenic
1089649663 11:119904495-119904517 CTTTGGGAGGAGAGGAGAGGAGG + Intergenic
1089754422 11:120676059-120676081 CCTTGTGGTTATAGGATGGGGGG + Intronic
1089792196 11:120953274-120953296 CCCTGGGAAGAGAGGAGGGGTGG + Intronic
1089816911 11:121184030-121184052 CTTTGGGAGGCGAAGATGGGAGG - Intronic
1090072885 11:123559837-123559859 GCCTGGGAGTAGAGGAAGAGAGG - Intronic
1090821571 11:130347132-130347154 CTTTGGGAGTCCAGGGTGGGAGG + Intergenic
1091737675 12:2936505-2936527 CCTTGGGAGGCCAAGATGGGCGG + Intronic
1091815866 12:3437514-3437536 ACTTGAGGGTAGAGGGTGGGAGG - Intronic
1091905798 12:4188266-4188288 CTTTGGGAGGACAGGGTGGGTGG + Intergenic
1092008898 12:5092983-5093005 ACTTGAGAGTGGAGGGTGGGAGG - Intergenic
1092150100 12:6242090-6242112 CCTTGGGAGGAGAGTCCGGGGGG - Intergenic
1092381726 12:8002175-8002197 CCTTGGGAGTCCAAGGTGGGCGG + Intergenic
1092412491 12:8264586-8264608 CCTTGGGGATAAAGGAGGGGAGG + Intergenic
1092441103 12:8505168-8505190 ACTTGAGGGTGGAGGATGGGAGG - Intergenic
1092505959 12:9100520-9100542 CTTTGGGAGAACGGGATGGGAGG - Intronic
1093495964 12:19758047-19758069 ACTTGAGAGTGGAGGATGGGAGG - Intergenic
1093497004 12:19769555-19769577 ACTTGAGAGTGGAGGATGAGAGG + Intergenic
1093541571 12:20293392-20293414 ACTTGAGGGTGGAGGATGGGAGG - Intergenic
1093547129 12:20361535-20361557 CCTTGGGAGTTCAGCAGGGGTGG + Intergenic
1093686028 12:22054873-22054895 ACTTGAGGGTAGAGGGTGGGAGG - Intronic
1093747037 12:22753854-22753876 ACTTGAGAGTGGAGGGTGGGAGG + Intergenic
1093947342 12:25124767-25124789 ACTTAGGAGTAGAGGGTGGGAGG - Intronic
1093963382 12:25300558-25300580 ACTGGGGAGAAGAGGGTGGGGGG - Intergenic
1093997063 12:25654194-25654216 ACCTGAGAGTGGAGGATGGGAGG + Intergenic
1095153230 12:38820161-38820183 CTTTGGGAGGCGAAGATGGGGGG + Intronic
1095497142 12:42797132-42797154 CTTTGGGAGGCGAAGATGGGAGG - Intergenic
1095548298 12:43398765-43398787 CTTTGGGAGGATAAGATGGGAGG + Intronic
1095836384 12:46643878-46643900 TCTTGAGGGTAGAGGGTGGGAGG + Intergenic
1096031887 12:48425228-48425250 ACTTGAGGGTGGAGGATGGGTGG - Intergenic
1096214525 12:49791991-49792013 CCTGGGGCGTAGGGGACGGGCGG + Exonic
1096953573 12:55502189-55502211 GCTTGAGGGTGGAGGATGGGAGG + Intergenic
1097000576 12:55873027-55873049 CTTTGGGAGGCGAAGATGGGCGG - Intergenic
1097168195 12:57096817-57096839 GCTTGGGAGTGGAGGCTGGGTGG - Intronic
1097249988 12:57627239-57627261 CCCTGGGAGTAGAGCAGGGGTGG + Intronic
1098308759 12:69127161-69127183 TCTTGGGGGTGGAGGGTGGGAGG - Intergenic
1099662851 12:85587542-85587564 ACTTGAGAGTAGAGGGTGTGAGG + Intergenic
1099860056 12:88215019-88215041 ACTTGAGGGTGGAGGATGGGAGG + Intergenic
1100127153 12:91441133-91441155 ACTTGAGGGTGGAGGATGGGGGG + Intergenic
1100484459 12:95011484-95011506 ACTTGGGAGGCTAGGATGGGAGG - Intergenic
1100534130 12:95490645-95490667 ACTTGGGAGGATAAGATGGGAGG - Intronic
1100635852 12:96433822-96433844 CACTGGGAGTAGAGGTTTGGAGG + Intergenic
1101257210 12:102990180-102990202 ACTTGAGGGTGGAGGATGGGAGG + Intergenic
1101423708 12:104570159-104570181 CTTTAGGAGTAGAGGTGGGGTGG - Intronic
1102026134 12:109715066-109715088 CGATGGGAGTGGAGGTTGGGGGG + Intronic
1102261820 12:111447633-111447655 CTGTGGGAGGAGAGGATGGTGGG - Intronic
1102860100 12:116328866-116328888 ACTTGTAGGTAGAGGATGGGAGG + Intergenic
1103374987 12:120448570-120448592 CTTTGGGAGGCGAAGATGGGCGG - Intronic
1103813533 12:123634698-123634720 GCTTGCGGGTAGAGGATGGTGGG + Intronic
1103957998 12:124589540-124589562 CTTTGGGAGGCCAGGATGGGAGG - Intergenic
1104671274 12:130682204-130682226 CCTTGGCAGTGGGGGAAGGGAGG - Intronic
1104971765 12:132534004-132534026 GCTGGGCCGTAGAGGATGGGAGG + Intronic
1104985639 12:132595322-132595344 CTTTGGGAGGCCAGGATGGGAGG + Intergenic
1105309750 13:19195799-19195821 CTTTGGGAGACCAGGATGGGAGG + Intergenic
1105527750 13:21191818-21191840 CTTTGGGAGACCAGGATGGGAGG - Intergenic
1105806042 13:23952078-23952100 CCTTCGGAGGAGCGGATGGAAGG - Intergenic
1105895629 13:24715246-24715268 GCTTCTGTGTAGAGGATGGGAGG + Intergenic
1106233235 13:27838979-27839001 CCTTGGGAGGCCAAGATGGGAGG - Intergenic
1106388294 13:29309422-29309444 CCTGTGGGGTGGAGGATGGGGGG + Intronic
1106545884 13:30731008-30731030 CGCTGGGAGCAGGGGATGGGTGG + Intronic
1106564526 13:30872916-30872938 CCTTGGGATTAGAGAGAGGGTGG - Intergenic
1107098537 13:36562392-36562414 CTTTGGGAGTCCAGGTTGGGAGG - Intergenic
1107176143 13:37400997-37401019 ACTTGAGAGTGGAGGGTGGGAGG + Intergenic
1107362049 13:39629618-39629640 CCTTGGGAGGCCAAGATGGGTGG - Intergenic
1107549965 13:41464945-41464967 CCTGGGCAGGAGAGGGTGGGGGG + Intronic
1108885149 13:55171122-55171144 ACTTGAGAGTAGAGGGTTGGAGG + Intergenic
1108964811 13:56284800-56284822 TCTTGAGAGTTGAGGGTGGGAGG - Intergenic
1109714179 13:66199554-66199576 ACTTGAGAGTAGAAGGTGGGAGG + Intergenic
1109833467 13:67825010-67825032 ACTTGAGGGTTGAGGATGGGAGG - Intergenic
1110224596 13:73106224-73106246 CTTTGGGAGTCCAAGATGGGTGG - Intergenic
1110421173 13:75310797-75310819 CCTTGAGGGTGGAGGGTGGGAGG - Intronic
1110460817 13:75743693-75743715 ACATGAGAGTGGAGGATGGGAGG + Intronic
1110584454 13:77172140-77172162 CTTTGGGAGTCCAAGATGGGTGG - Intronic
1110994880 13:82094679-82094701 ACTTCGGGGTAGAGAATGGGAGG + Intergenic
1111064258 13:83070410-83070432 ACTTGAGGGTGGAGGATGGGAGG - Intergenic
1111100088 13:83572213-83572235 CCTGGAGGGTGGAGGATGGGAGG - Intergenic
1111288669 13:86131491-86131513 ACTTGAGGGTGGAGGATGGGAGG - Intergenic
1111584724 13:90269579-90269601 CTTTGGTAGACGAGGATGGGTGG + Intergenic
1111664759 13:91253302-91253324 CCTTGGGACTATATGATGTGGGG - Intergenic
1111701739 13:91698142-91698164 CCTTGGGAGGCCAAGATGGGTGG - Intronic
1111892378 13:94099956-94099978 ACTTGAGGGTAGAGGGTGGGAGG + Intronic
1112318293 13:98384434-98384456 CTTTGGGAGTCCAGGACGGGTGG - Intronic
1113030696 13:105990748-105990770 GGTTGGGTGTGGAGGATGGGGGG - Intergenic
1113259403 13:108545152-108545174 CCCTGAGGGTAGAGGATGGGAGG - Intergenic
1113593241 13:111515006-111515028 GCATGGGATTAGAGGATGGGAGG + Intergenic
1113704806 13:112421955-112421977 ACTTGAGAGTGGAGAATGGGAGG + Intronic
1114261497 14:21039997-21040019 CCTTTGGAGTGGAGGCTGGATGG - Intronic
1115005098 14:28472893-28472915 ACTTGAGAGTGGAGGCTGGGAGG - Intergenic
1115133091 14:30076664-30076686 ACTTGAGAGTGGAGGGTGGGAGG + Intronic
1115208601 14:30941551-30941573 TCTTTGGAGTAGGGGAGGGGTGG + Intronic
1116030413 14:39564529-39564551 CCTTGGGAGGCCAAGATGGGCGG - Intergenic
1116082835 14:40198356-40198378 TTTAGGGAGTAGAGGGTGGGAGG + Intergenic
1116120147 14:40712364-40712386 ACTTGAGGGTGGAGGATGGGAGG + Intergenic
1116316987 14:43410078-43410100 GCTTGAGGGTAGAGGATGGTAGG - Intergenic
1116496959 14:45572674-45572696 ACTTGAGAGGGGAGGATGGGAGG - Intergenic
1116709802 14:48353411-48353433 CATTGGGACTAGTGAATGGGAGG - Intergenic
1116723116 14:48526433-48526455 ACCTGGGAGTAGAGGATTAGAGG - Intergenic
1116816611 14:49590031-49590053 ACTTGAGGGTAGAGGGTGGGAGG + Intronic
1116931665 14:50696889-50696911 CCTTGAGAGTGGAGGGTGGGAGG - Intergenic
1117043106 14:51785963-51785985 CCTTGAGGGTAGAAGGTGGGAGG - Intergenic
1117160083 14:52980869-52980891 CTTTGGGAGGACAAGATGGGAGG - Intergenic
1117364620 14:55013660-55013682 CTTTGGGAGTACAAGGTGGGAGG + Intronic
1117438204 14:55737600-55737622 CCTTTGGAGAAGAGCCTGGGTGG - Intergenic
1117527136 14:56620133-56620155 ACTTGAGAGTGGAGGCTGGGAGG + Intronic
1118159680 14:63275898-63275920 CCTTGGGACTGGGGGTTGGGGGG - Intronic
1118536035 14:66765606-66765628 ACTTGAGGGTAGAGGGTGGGAGG + Intronic
1119527458 14:75333843-75333865 CCTGGGGAGGAGGGGAGGGGGGG + Intergenic
1120243849 14:81982754-81982776 CCATGGGACTAGAGAATGGGTGG + Intergenic
1121029802 14:90648458-90648480 CCTTGGGAGGCTAAGATGGGAGG - Intronic
1121211074 14:92208166-92208188 ACTTGGGTTTAGAGGAGGGGTGG + Intergenic
1121254777 14:92523353-92523375 CTTTGGGAGGCCAGGATGGGTGG - Intronic
1121440686 14:93947280-93947302 CACTGGGAGTAGGGGATTGGAGG - Intronic
1121447591 14:93988425-93988447 AGATGGGAGGAGAGGATGGGAGG + Intergenic
1121447745 14:93988834-93988856 GCATGGGAGGAGGGGATGGGAGG + Intergenic
1121798027 14:96751878-96751900 ACTTGGGGGTGGAGGGTGGGAGG + Intergenic
1122514260 14:102295890-102295912 CTTTGGGAGTGCAAGATGGGAGG + Intronic
1123419235 15:20118052-20118074 CTTTGAGGGTAGAGGGTGGGAGG + Intergenic
1123446630 15:20335447-20335469 CTTTGAGGGTAGAGGGTGGGAGG - Intergenic
1123528457 15:21124595-21124617 CTTTGAGGGTAGAGGGTGGGAGG + Intergenic
1124412804 15:29450947-29450969 ACTTGAGAGAAGAGGGTGGGAGG + Intronic
1124849320 15:33321002-33321024 CCTTGGGAGTACAGATTGGGAGG + Intronic
1125293166 15:38172303-38172325 ACTTGGGATTTGAGGATGGTTGG + Intergenic
1125444408 15:39737819-39737841 GCTGGAGAGTAGAGGCTGGGAGG - Intronic
1126195947 15:45932072-45932094 CCTTGAGGATGGAGGATGGGAGG - Intergenic
1126659302 15:51016449-51016471 CCTTGAGGGTGGAGGGTGGGAGG + Intergenic
1126700477 15:51362239-51362261 CTTTGGGAGTAGAAGGCGGGCGG + Intronic
1126993338 15:54409525-54409547 CCTTGAGGGTGGAGGGTGGGAGG - Intronic
1127245769 15:57172623-57172645 CCTTGAAGGTAGAGGGTGGGAGG + Intronic
1128369332 15:67028766-67028788 ACTTGAGAGTAAAGGGTGGGAGG + Intergenic
1128661223 15:69502453-69502475 CTTTGGGAGGACAAGATGGGCGG - Intergenic
1129585420 15:76858613-76858635 ACTTGAGGGTAGAGGGTGGGAGG - Intronic
1129796595 15:78382194-78382216 CTTTGGGAGTCCAGGGTGGGAGG - Intergenic
1129956601 15:79642781-79642803 ACTTGAGGGTGGAGGATGGGAGG + Intergenic
1130838229 15:87672664-87672686 GCTAGGGAGTTGAGGCTGGGAGG - Intergenic
1131308008 15:91262607-91262629 ACTTGGGGGTGGAGGGTGGGAGG - Intronic
1131768112 15:95702193-95702215 CTTTGGGAGTACAAGGTGGGAGG + Intergenic
1131818707 15:96249475-96249497 CCTTGGGAGGCCAAGATGGGAGG - Intergenic
1132144638 15:99421774-99421796 CCTTGAGAGTGGAGAGTGGGAGG - Intergenic
1132288645 15:100684145-100684167 CCTTGAGGGTGGAGGCTGGGAGG - Intergenic
1132308335 15:100835183-100835205 CCTTGAGGGTGGAGGTTGGGAGG - Intergenic
1133353760 16:5120823-5120845 CCTTGGGGATAAAGGAGGGGAGG + Intergenic
1134511034 16:14846947-14846969 CTTTGGGAGGCCAGGATGGGAGG + Intronic
1134564861 16:15242711-15242733 ACTTGAAGGTAGAGGATGGGAGG + Intergenic
1134737635 16:16513987-16514009 ACTTGAAGGTAGAGGATGGGAGG - Intergenic
1134929870 16:18198173-18198195 ACTTGAAGGTAGAGGATGGGAGG + Intergenic
1134973158 16:18549230-18549252 CTTTGGGAGGCCAGGATGGGAGG - Intronic
1135137990 16:19898756-19898778 CTTTGGGAGTCCGGGATGGGAGG + Intergenic
1136671449 16:31862255-31862277 ACTGGAGAGTAGAAGATGGGGGG - Intergenic
1136925178 16:34365483-34365505 GCTTGGGAGTAGGGCATGGAGGG + Intergenic
1136931099 16:34418552-34418574 CTTTGGGAGTTGAAGGTGGGAGG - Intergenic
1136973474 16:34993256-34993278 CTTTGGGAGTTGAAGGTGGGAGG + Intergenic
1136979395 16:35046323-35046345 GCTTGGGAGTAGGGCATGGAGGG - Intergenic
1137463319 16:48685767-48685789 GCTTGGGGGTGGAGGTTGGGAGG + Intergenic
1137573010 16:49578970-49578992 GCTTGGGAGCAGAGGAAGCGGGG - Intronic
1137638322 16:50006915-50006937 ACTTGAGAGTGGAGAATGGGAGG + Intergenic
1138348925 16:56336126-56336148 CCTCGGGAGTAGAGTCTGAGAGG + Intronic
1138920011 16:61515842-61515864 CCTTGGGGGTCGGGGAGGGGAGG + Intergenic
1139027723 16:62839502-62839524 CCTTGGGAGGCGAAGGTGGGAGG + Intergenic
1139377136 16:66506782-66506804 CTTTGGGAGGCCAGGATGGGCGG - Intronic
1140100811 16:71914915-71914937 TCTTGCGGGTAGAGGACGGGTGG + Intronic
1140105650 16:71957552-71957574 CTTTGGGAGGAGAAGGTGGGAGG + Intronic
1140351587 16:74266865-74266887 CCTTGGGAGGTCAAGATGGGAGG + Intergenic
1140561542 16:75988008-75988030 ACTTGAGAGTGGAGGGTGGGAGG - Intergenic
1141147166 16:81539317-81539339 CCTTGGGGGTGGAGGATGATGGG + Intronic
1141524278 16:84601695-84601717 CTTTGGGAGGCCAGGATGGGGGG - Intronic
1143348460 17:6268121-6268143 ACTTGAGGGTAGAGGGTGGGAGG - Intergenic
1143503780 17:7352979-7353001 CCTTGGGAATTGAGGTTGGGGGG - Exonic
1144499156 17:15770285-15770307 CCGTGGGAGTAGAGGGAGGTGGG + Intergenic
1144923608 17:18784401-18784423 CTTTGGGAGGCCAGGATGGGTGG + Intronic
1145162538 17:20585321-20585343 CCGTGGGAGTAGAGGGAGGTGGG + Intergenic
1145218935 17:21072900-21072922 CCTAGGGAGTAGGGGATGTGGGG - Intergenic
1146732484 17:35205937-35205959 CTTTGGGAGCACAAGATGGGAGG - Intergenic
1147174199 17:38642648-38642670 CTTTGGGAGTCCAGGGTGGGCGG + Intergenic
1147177384 17:38664266-38664288 CCCTGGGGGTAGAGGCAGGGGGG - Intergenic
1147252700 17:39162915-39162937 CTTTGGGAGTAGAGCATTTGGGG - Intronic
1147413248 17:40269400-40269422 ACTTGGGAGGCTAGGATGGGAGG + Intronic
1147935598 17:44008855-44008877 CCTGGGGATTAGGGGAGGGGAGG + Exonic
1148155769 17:45424654-45424676 ACTTGGGAGTGGGGGAAGGGTGG + Intronic
1148486814 17:47996123-47996145 CCTTGGGAGCAGATGGTGGGAGG - Intergenic
1148576748 17:48717697-48717719 CTTTGGGAGGACAAGATGGGAGG - Intergenic
1148895316 17:50836043-50836065 GCGTGGGAATAGCGGATGGGCGG - Exonic
1149153602 17:53599180-53599202 ATTTGAGAGTAGAGGGTGGGAGG - Intergenic
1149362119 17:55906355-55906377 ACTTGAGGGTAGAGGGTGGGAGG - Intergenic
1149449670 17:56739808-56739830 GCTTGGGAGTGGGGGATGGAGGG - Intergenic
1149460737 17:56828160-56828182 CTTTGGGAGGACAGGGTGGGTGG + Intronic
1149461130 17:56831191-56831213 CCAGGGGAGTAGTGGAGGGGGGG + Intronic
1149565509 17:57638181-57638203 CCTGGAGAGGAGAGGGTGGGGGG - Intronic
1150387459 17:64773321-64773343 ACTTGGGAGTGGGGGAAGGGTGG + Intergenic
1150783635 17:68144191-68144213 CCTTGGGAGGCCAAGATGGGAGG - Intergenic
1150869905 17:68895826-68895848 CCTTAGGATTAGGGAATGGGTGG - Intronic
1152196372 17:78920778-78920800 CCTGGGCAGTTGAGGAGGGGAGG + Intronic
1152275330 17:79353284-79353306 CCCATGGAGGAGAGGATGGGAGG - Intronic
1152378010 17:79928654-79928676 CCTTGGGAGGTGAGGGTGGGAGG - Intergenic
1152760762 17:82105959-82105981 CCTTTGGAGCAGAGGAGAGGTGG + Intronic
1153155736 18:2146726-2146748 CTTTGGGAGAATGGGATGGGAGG - Intergenic
1153172043 18:2327620-2327642 CTTTGGGAGGAGGAGATGGGTGG - Intergenic
1153360139 18:4185405-4185427 ACTTGGGAGTCGAGGGTTGGAGG - Intronic
1153615525 18:6929884-6929906 CCTTTGGAGTGGCGGTTGGGCGG - Intergenic
1153876667 18:9378726-9378748 CCTTGGGAGGCCAAGATGGGTGG + Intronic
1154402024 18:14048447-14048469 ACTTGAGAGGAGAGGGTGGGAGG - Intergenic
1154428757 18:14292153-14292175 CAGTGGGAGTTGAGGGTGGGTGG + Intergenic
1154433233 18:14324316-14324338 CAGTGGGAGTTGGGGATGGGGGG + Intergenic
1155016988 18:21852984-21853006 CCAGGAAAGTAGAGGATGGGAGG + Intronic
1155907256 18:31467095-31467117 CTTTGGGAGGCCAGGATGGGAGG + Intronic
1157315591 18:46586689-46586711 CTTTGGGAGTCCAAGATGGGTGG - Intronic
1159784549 18:72697463-72697485 CTTTGGGAGGGCAGGATGGGTGG + Intergenic
1159973949 18:74687102-74687124 CTTTGGGAGGCCAGGATGGGAGG + Intronic
1160138885 18:76301004-76301026 GCTTGAGGGTAGAGGGTGGGAGG + Intergenic
1160785509 19:898686-898708 GATGGGGAGTAGAGGACGGGGGG - Intronic
1160817478 19:1042837-1042859 CCATGGGGGTTGAGGATGAGTGG - Intronic
1160826305 19:1082085-1082107 CCTGGGGAGGACAGGGTGGGCGG + Intronic
1161813871 19:6487168-6487190 CCTTGGGAGGCTGGGATGGGAGG - Intergenic
1161898435 19:7099674-7099696 TCTTGGGAGCAGGGGAAGGGAGG + Intergenic
1162565244 19:11442300-11442322 CCTGTGGAGTAGAGGCAGGGAGG + Intronic
1162732472 19:12727128-12727150 CCTTGGGGGTGGAGTATGGGGGG - Intergenic
1162732840 19:12729271-12729293 TCTTGGTAGTAGAGGAGGTGAGG - Intergenic
1163687143 19:18718149-18718171 GCTGGGGAGGAGAGGAGGGGAGG - Intronic
1163793732 19:19323435-19323457 CTTTGGGAGGACAAGATGGGCGG - Intronic
1163865253 19:19768184-19768206 ACTTGGGAGTCTGGGATGGGAGG + Intergenic
1163965834 19:20746442-20746464 ACTTGAGAGTAGAGGGTGTGAGG - Intronic
1164482160 19:28620229-28620251 CTCTGGGAGTTGAGGGTGGGAGG - Intergenic
1165048981 19:33129327-33129349 CCTTGGGAGGTCAAGATGGGAGG + Intronic
1165299086 19:34956706-34956728 CCTTGGGAGCAAAGAATGGCTGG + Exonic
1165467097 19:35981427-35981449 ACTTGGGAGGCAAGGATGGGAGG - Intergenic
1165737685 19:38187206-38187228 CTTTGGGAGTCCAGGATGGGTGG + Intronic
1165781358 19:38436151-38436173 CCTTGGGAGGCCAAGATGGGTGG - Intronic
1166025523 19:40080670-40080692 ACTTGAGAGTAGAGGGTGGGAGG + Intronic
1166068331 19:40373331-40373353 TTTTGGGAGTCCAGGATGGGCGG + Intronic
1166088428 19:40492252-40492274 CCTGGGGACTAGAGGATGATGGG + Intronic
1166356464 19:42230313-42230335 CCTTGGGGGCAGAGGACAGGAGG + Exonic
1167221264 19:48200100-48200122 ACTAGGGGGTGGAGGATGGGAGG + Intronic
1167319992 19:48791338-48791360 CTTTGGGAGGATAAGATGGGCGG + Intergenic
1167574856 19:50313036-50313058 CCGTGGGAGCAGAGGGAGGGAGG + Intronic
1167836679 19:52078046-52078068 CCTTGGGAGGCCAAGATGGGTGG + Intronic
1168516294 19:57012915-57012937 CCACGGGAGCAGTGGATGGGTGG + Intergenic
925372384 2:3356169-3356191 CCATGGGGGTAGGGGTTGGGTGG - Intronic
925661519 2:6208316-6208338 CCCTGGGAGTAGAGGGAGGGAGG + Intergenic
926020198 2:9487940-9487962 ACTTGGGAGGCGAAGATGGGAGG - Intronic
926531306 2:14049665-14049687 CCTTGAGGGCAGAGGGTGGGAGG - Intergenic
926722565 2:15971981-15972003 CCTTGGGAGATGAAGGTGGGTGG + Intergenic
926856379 2:17260663-17260685 CCTTGAGGGTAGAGGGTGAGAGG - Intergenic
927165618 2:20317701-20317723 CCTTGAGGGTAGAGGGTGGGAGG - Intronic
927517314 2:23679972-23679994 CCCTGGGAGTGGAGGAGGAGCGG + Intronic
927565617 2:24110276-24110298 GCTTGAGAGTGGAGGGTGGGAGG + Intronic
927582065 2:24260162-24260184 CTTTGGGAGTCCAAGATGGGAGG - Intronic
927645675 2:24875365-24875387 CCGTGGGTGTAGCTGATGGGAGG + Intronic
928180586 2:29065644-29065666 CCTTGGGAGTGCAGAATGGAGGG + Intronic
928313644 2:30230717-30230739 ACGTGGGAGTCAAGGATGGGGGG + Intergenic
928380087 2:30810138-30810160 CCTGGGGAGTGAAGGATGTGGGG + Intronic
928886142 2:36150671-36150693 ACTTGAGGGTAGAGGATGGGAGG + Intergenic
929127182 2:38532754-38532776 GCTGTGGAGAAGAGGATGGGAGG - Intergenic
929795000 2:45052436-45052458 CCCAGAGAGGAGAGGATGGGAGG - Intergenic
929896568 2:45966072-45966094 CCTTGGGAGGCGTGGATGGCTGG + Intronic
930077167 2:47415822-47415844 CTTTGGGAGTCCAGGGTGGGAGG + Intronic
930284294 2:49408924-49408946 CCTTGGAAGCAGAGCCTGGGAGG - Intergenic
931892039 2:66683743-66683765 CCTTGGGAGTATAGCACGTGGGG + Intergenic
932132644 2:69201678-69201700 GCCTGGGTGTAGAGGATGAGAGG + Intronic
932222579 2:70011101-70011123 CCTTGAGGGTGGAGGGTGGGGGG + Intergenic
932454464 2:71838843-71838865 CTTTGGGGGTGGAGGAGGGGAGG + Intergenic
932751291 2:74373335-74373357 CCTTGGGAGTGGTGGCTGGGCGG - Intronic
933182225 2:79240366-79240388 CCTTGAGGATAGAGGGTGGGAGG - Intronic
933593074 2:84254531-84254553 CCTTGAGGGTAGAGGGTGGGAGG - Intergenic
933826631 2:86167414-86167436 CTTTGGGAGTCCAGGGTGGGCGG - Intronic
934090668 2:88547930-88547952 TCTTGGAAGTAGTGGATGGGTGG + Intergenic
934975558 2:98799761-98799783 CCTTGGGATTTGGGGTTGGGTGG - Intronic
935575895 2:104710155-104710177 CCTTAAGAGAAGAGGGTGGGTGG - Intergenic
936282313 2:111152750-111152772 CATTGGGAGAAGAGGAGGGGAGG - Intronic
936752764 2:115666042-115666064 ACTTGAGGGTGGAGGATGGGAGG - Intronic
936782078 2:116045607-116045629 ACTTGAGGGTGGAGGATGGGAGG + Intergenic
936916305 2:117642157-117642179 CCATGGGAGCAGAGGATTAGTGG + Intergenic
937141969 2:119609774-119609796 ACTTGGCAGCAGTGGATGGGTGG + Intronic
937316827 2:120937035-120937057 CCTTGGAAGGAGGGGATGGAGGG - Intronic
937571691 2:123370884-123370906 ACTTGAGAGTGGTGGATGGGAGG + Intergenic
937831065 2:126424200-126424222 ACTTGAGAGTAGAGGATGGGAGG + Intergenic
939330551 2:140753896-140753918 CCCTATGAGTACAGGATGGGTGG - Intronic
939362648 2:141193582-141193604 ACTTGAGGGTGGAGGATGGGAGG + Intronic
939630463 2:144522423-144522445 CCTTAGGAGTGGTGGAAGGGTGG - Intronic
939700889 2:145389108-145389130 TATTGGGAGTGGAGGGTGGGAGG - Intergenic
939710291 2:145509142-145509164 CCTGGGGGATAGAGGAAGGGTGG - Intergenic
940828706 2:158443253-158443275 TCTTGGGAGTCCAGGGTGGGAGG + Intronic
940831685 2:158473648-158473670 ACTTGAGGGTAGAGGGTGGGAGG + Intronic
941124960 2:161573550-161573572 ACTTGAGAGTGGAGGATGGGAGG - Intronic
941239852 2:163023863-163023885 ACTTGAGGGTGGAGGATGGGAGG - Intergenic
941566001 2:167109016-167109038 ACTTGAGGGTAGAGGGTGGGAGG - Intronic
941995110 2:171594839-171594861 ACTTGGGGGTGGAGGATGGGAGG + Intergenic
941995865 2:171601475-171601497 CTTTGGGAGTCCAAGATGGGAGG + Intergenic
942042915 2:172082784-172082806 CCTTAGCAGTAGGGGGTGGGAGG + Intergenic
942461383 2:176171113-176171135 CCCTGGCAGCAGAGGCTGGGAGG + Intronic
942607896 2:177711252-177711274 CTATGGGAGTAGGGAATGGGAGG + Intronic
942988414 2:182169571-182169593 CCTTGGATGAAGAGGATTGGTGG + Intronic
943635244 2:190299813-190299835 ACTTGAGAGTCGAGGATAGGAGG - Intronic
944531314 2:200670308-200670330 CAGTGTGAGTGGAGGATGGGAGG - Intronic
944774182 2:202945458-202945480 ACTTGAGAGTGGAGGGTGGGAGG - Intronic
945246069 2:207718145-207718167 CCTTGGGAGGCCAGGGTGGGTGG - Intronic
945333502 2:208565621-208565643 CTTTGGGAGGCGAGGGTGGGTGG + Intronic
945594341 2:211773178-211773200 CCTTGGTAGCAGAGGCTGGGAGG + Intronic
945604114 2:211906699-211906721 ACTTGAGGGTAGAGGGTGGGAGG - Intronic
945829590 2:214766970-214766992 ACTTGAGTGTGGAGGATGGGAGG - Intronic
946078902 2:217099659-217099681 CCTTGGGAATAGAAATTGGGTGG - Intergenic
946244211 2:218376957-218376979 CTTTGGGAGTCCAAGATGGGTGG - Intergenic
946299662 2:218814808-218814830 TCCTGGGAGGAGAGGAAGGGAGG + Intronic
946433326 2:219636926-219636948 CCTGGGGAGGACAGCATGGGAGG + Intronic
946884848 2:224212826-224212848 CCCTGAGGGTAGAGGGTGGGAGG - Intergenic
947528715 2:230895083-230895105 CTTTGGGAGTCCAAGATGGGTGG + Intergenic
947699858 2:232223842-232223864 CTTTGGGAGGACAAGATGGGAGG + Intronic
947736536 2:232458146-232458168 CCTGGGGAGTGGAGGAAGGCGGG + Intronic
947753906 2:232547161-232547183 CCTTGGGAGGACAAGGTGGGTGG + Intergenic
948449433 2:238060355-238060377 GATCTGGAGTAGAGGATGGGAGG - Intronic
948756670 2:240163432-240163454 CCCTGGGGGTATGGGATGGGAGG - Intergenic
1168773419 20:430335-430357 CCTGGGCCCTAGAGGATGGGAGG - Exonic
1168845037 20:938736-938758 TTTTGGGAGTAGGGGAGGGGAGG - Intergenic
1169014398 20:2279884-2279906 CGTTGAGAGGAGAGGATGTGTGG + Intergenic
1169024636 20:2358853-2358875 ACTTGGGGGTGGAGGGTGGGAGG - Intergenic
1170390548 20:15868363-15868385 CCTGGAGAGTAGGGGTTGGGTGG - Intronic
1170580773 20:17697959-17697981 CTTTGGGAGGCCAGGATGGGCGG + Intronic
1171138547 20:22720530-22720552 CCTTGAGGGTGGAGGGTGGGAGG - Intergenic
1172011985 20:31850903-31850925 CATTGGGAGAAGAGGCTGTGAGG + Intronic
1172278588 20:33694667-33694689 GCTTGGGAGGAGAGAATGGGAGG - Intergenic
1172600297 20:36178465-36178487 CCTTGGGACTAGGGGGTGAGGGG - Intronic
1172730454 20:37082751-37082773 CTTTGGGAGGCGAAGATGGGTGG + Intronic
1172863857 20:38079407-38079429 ACTTGAGGGTGGAGGATGGGAGG - Intronic
1173697564 20:45032418-45032440 CCTTGAGGGCAGAGGGTGGGAGG - Intronic
1173712364 20:45170995-45171017 ACTTGAGGGTAGAGAATGGGAGG + Intergenic
1173766117 20:45611199-45611221 CCTAGGGAGTAGAGGGAGGACGG - Intronic
1173961488 20:47075849-47075871 ACTTGAGGGTAGAGGATGGAAGG - Intronic
1174083409 20:47987154-47987176 CATTAGGAGTAGAGGAAGGAAGG - Intergenic
1174683385 20:52430188-52430210 ACTTGAGGGTGGAGGATGGGAGG + Intergenic
1176380141 21:6108282-6108304 CCTTAGGCGTCGAAGATGGGAGG + Intergenic
1176801047 21:13431379-13431401 ACTTGGGAGTCTGGGATGGGAGG + Intergenic
1178019352 21:28391809-28391831 ACTTGAGAGTGGAGGATGGGAGG + Intergenic
1178278194 21:31257990-31258012 ACTTGGAAGGAGAGGAGGGGAGG - Intronic
1178557138 21:33602081-33602103 CCTTGGGAAGCCAGGATGGGAGG - Intronic
1178598725 21:33977739-33977761 CTTTGGGAGGTGACGATGGGAGG + Intergenic
1178615846 21:34132171-34132193 CCCTGGGAGAAGAGGTCGGGAGG + Intronic
1178661294 21:34509908-34509930 ACTTGAGAGTGGAGGGTGGGAGG - Intergenic
1178979843 21:37254386-37254408 CTTTGGGAGGCTAGGATGGGAGG + Intronic
1179164142 21:38922490-38922512 ACTTGAGGGTAGAGGGTGGGAGG - Intergenic
1179217770 21:39381980-39382002 CTTTGGGAGGCCAGGATGGGTGG - Intronic
1179386293 21:40945943-40945965 ACCTGAGAGTAGAGTATGGGAGG + Intergenic
1179743333 21:43429956-43429978 CCTTAGGCGTCGAAGATGGGAGG - Intergenic
1181254874 22:21555989-21556011 CTTTGGGAGGCGGGGATGGGTGG + Intronic
1181464275 22:23102390-23102412 CCCTGGGAGCAGAGGAAGGAAGG - Intronic
1182155663 22:28070536-28070558 CTTTGGGAGGACAAGATGGGTGG + Intronic
1182319239 22:29467567-29467589 CTTAGGGCATAGAGGATGGGTGG + Intergenic
1182441254 22:30365655-30365677 CTTTGGGAGGAAAGGATGGTAGG + Intronic
1182562385 22:31170751-31170773 CTTTGGGAGTACAAGGTGGGTGG - Intronic
1183205430 22:36415670-36415692 TCATGGGAGTTGAGTATGGGAGG - Intergenic
1183286175 22:36965644-36965666 CACTGGGAGTAGGGGATAGGGGG - Intergenic
1184137868 22:42560053-42560075 CTTTGGGAGGACAAGATGGGCGG - Intronic
1184197630 22:42941043-42941065 GATTGGGAGTAGAGGAGGTGGGG - Intronic
1184692793 22:46124831-46124853 CCTTGGGAGCATGGGATAGGAGG + Intergenic
1185046644 22:48531783-48531805 TCCTGGGAGGAGAGGCTGGGAGG + Intronic
1185219893 22:49624008-49624030 CCAGGAGAGTGGAGGATGGGAGG - Intronic
1185270947 22:49929157-49929179 CCCGGGGAGTCGAGGACGGGAGG + Intergenic
949963710 3:9336973-9336995 CCTTGGGAGTGAAAGGTGGGAGG - Intronic
950035512 3:9882464-9882486 GGCTGGGAGTAGGGGATGGGAGG + Intergenic
950062154 3:10080525-10080547 CTTTGGGAGTCCAAGATGGGTGG + Intronic
950309569 3:11944997-11945019 ACTTGAGAGTAGAGGGTGGGAGG - Intergenic
950702123 3:14757870-14757892 CCTTAGAACTAGAGGATGAGCGG - Intronic
950889849 3:16394121-16394143 CTTTGGGAGGCCAGGATGGGAGG + Intronic
950905157 3:16531093-16531115 CCTGTGGTGTAGAGGATGGCTGG + Intergenic
950939234 3:16876592-16876614 TTTTTGGAGTAGGGGATGGGAGG + Intronic
951531990 3:23706521-23706543 CCTTGGGAGGCCAAGATGGGAGG + Intergenic
952436006 3:33273065-33273087 GCTGGGGAGTAGAGGATGCTAGG + Intergenic
953040732 3:39252902-39252924 CCTGGGGAGGAGTGGCTGGGAGG + Intergenic
954008986 3:47618296-47618318 CCTTGGGAGGAGAAGGTAGGAGG + Intronic
954030977 3:47819781-47819803 CATTGGCAGTGGAGGAAGGGGGG - Intronic
954179737 3:48872371-48872393 CCTTGGGAGGCCAGGATGGGTGG - Intronic
955216253 3:56986966-56986988 CCTTGGGAGGCCATGATGGGAGG + Intronic
955886242 3:63601492-63601514 ACTTGAGAGTGGAGGGTGGGAGG - Intronic
955944610 3:64180774-64180796 CCTTGGGAGGCCAAGATGGGTGG - Intronic
956032270 3:65051406-65051428 ACTTGAGGGTAGAGGGTGGGAGG - Intergenic
956350763 3:68333471-68333493 ACTTGAGTGTAGAGGGTGGGTGG + Intronic
956577452 3:70768962-70768984 ACTTGAGGGTAGAGGGTGGGAGG - Intergenic
956843665 3:73162550-73162572 GGATGGGAGTAGATGATGGGAGG + Intergenic
956933237 3:74070345-74070367 ACTTGGGAGTGGAGGGTGGGAGG + Intergenic
957057711 3:75456813-75456835 CCTTGGGGATAAAGGAGGGGAGG + Intergenic
957901359 3:86497576-86497598 ACTTGAGGGTAGAGGGTGGGAGG + Intergenic
957951326 3:87131163-87131185 ACTTGGGGGTGGAGGGTGGGAGG - Intergenic
958843274 3:99234627-99234649 ACTTGAGGGTAGAGGGTGGGAGG - Intergenic
959111772 3:102131265-102131287 CCTTGAGGGTAAAGGGTGGGAGG + Intronic
959610590 3:108290487-108290509 ACTTGAGAGTGGAGGGTGGGAGG - Intergenic
960005435 3:112776687-112776709 CTTTGGGAGGTGAGGGTGGGCGG + Intronic
960098166 3:113708202-113708224 ACTTGAGGGTAGAGGGTGGGAGG + Intergenic
960721731 3:120631074-120631096 ACTTGAGAATAGAGGGTGGGAGG + Intronic
961053166 3:123764696-123764718 CCTTGGGTGTACAGGAGGAGAGG + Intronic
961236927 3:125375168-125375190 CCTTGAGAGGAGGGGAAGGGGGG + Exonic
961724072 3:128914437-128914459 CCTTAGGAGTCGAGGAGGAGAGG + Intronic
961890052 3:130123242-130123264 CCTTGGGGATAAAGGAGGGGAGG + Intergenic
962073901 3:132060206-132060228 ACTTGAGAGTGGAGGGTGGGAGG - Intronic
962089701 3:132230374-132230396 ACTGGGGAGGAGAGGGTGGGAGG - Intronic
962206917 3:133442396-133442418 CTTTGGGAGGACAGGGTGGGTGG - Intronic
962330190 3:134471591-134471613 CCCTGAGAGTAGGGGCTGGGAGG + Intergenic
962513045 3:136121428-136121450 GCTTGAGGGTAGAGGATAGGAGG + Intronic
962732710 3:138298664-138298686 CCTAAGGAGAAGAGGATGGAGGG - Intronic
963638606 3:147831104-147831126 CTTTGGGAGGCGGGGATGGGGGG - Intergenic
963674405 3:148290953-148290975 CCTTGAGGGTGGAGGGTGGGAGG + Intergenic
964158837 3:153621281-153621303 ACTTGAGGGTAGAGGGTGGGAGG + Intergenic
964246572 3:154660606-154660628 ACTTGGGAGTAGAGGATAAAAGG + Intergenic
964366331 3:155954412-155954434 ACTTGAGGGTAGAGGGTGGGAGG - Intergenic
964687690 3:159415444-159415466 ACTTGAGGGTAGAGGGTGGGAGG - Intronic
964893953 3:161571692-161571714 ACTTGGGAGCAGAGGCTAGGAGG - Intergenic
965058817 3:163755880-163755902 ACTTGAGGGTGGAGGATGGGAGG + Intergenic
965187039 3:165477957-165477979 ACTTGAGAGTGGAGGTTGGGAGG - Intergenic
965227672 3:166010390-166010412 CTTTGGGAGTCTAAGATGGGAGG - Intergenic
965379760 3:167973943-167973965 CAGTGGGAGCAGAGGATGAGTGG - Intergenic
965466777 3:169039572-169039594 ACTTGAGAGTGGAGGGTGGGAGG + Intergenic
966168625 3:177051290-177051312 CCTGGGGGGTGGAGGGTGGGAGG + Intronic
967142104 3:186570074-186570096 ACTTGGGAGGAGGGGAGGGGTGG + Intronic
967542998 3:190691016-190691038 ACTTGGGAGGACAGAATGGGAGG + Intergenic
967619073 3:191610027-191610049 ACTTGAGAGTGGAGGGTGGGAGG - Intergenic
967640334 3:191855165-191855187 CCTTGAGTGTGGAGGATGGAAGG + Intergenic
967768633 3:193310016-193310038 ACTTGAGAGCAGAGGGTGGGAGG - Intronic
967931563 3:194694083-194694105 TCTGGGGAGTAGGGGGTGGGGGG - Intergenic
968019234 3:195369416-195369438 CCTTGAGGGTGGAGGGTGGGAGG - Intronic
968295310 3:197571817-197571839 CTTTGGGAGAACAAGATGGGAGG + Intronic
968825463 4:2893170-2893192 CTTTGGGAGGCGAAGATGGGTGG - Intronic
968856238 4:3125890-3125912 CTTTGTGAGTAGGGGATGGCAGG + Intronic
969000525 4:3977226-3977248 CCTTGGGGATAAAGGAGGGGAGG + Intergenic
969453618 4:7288641-7288663 CCTTGGAAGAAGAGGAAGTGGGG - Intronic
969753488 4:9131443-9131465 CCTTGGGGATAAAGGAGGGGAGG - Intergenic
969813392 4:9667626-9667648 CCTTGGGGATAAAGGAGGGGAGG - Intergenic
970555176 4:17224723-17224745 CTTTGAGGGTGGAGGATGGGAGG - Intergenic
971273974 4:25177980-25178002 CTTTGGGAGGACAAGATGGGCGG + Intronic
971709295 4:30091003-30091025 ACTTGAGAGTGGAGGATGGCAGG + Intergenic
971829499 4:31672400-31672422 CCTTGAGGGTGGAGGGTGGGAGG - Intergenic
972105952 4:35487482-35487504 ACTTGAGGGTGGAGGATGGGAGG + Intergenic
972317667 4:37942781-37942803 CTTTGGGAGTGCAAGATGGGTGG - Intronic
973289080 4:48452360-48452382 ACTTGAGAGTGGAGGGTGGGAGG + Intergenic
973730773 4:53820324-53820346 CCTTGGGAGGCCAAGATGGGAGG - Intronic
973740372 4:53913862-53913884 ACTTGAGGGTGGAGGATGGGAGG + Intronic
974183733 4:58418107-58418129 CTTTGGGAGTGCAAGATGGGTGG - Intergenic
974365811 4:60947301-60947323 CTTTGGGAGGTGAAGATGGGAGG - Intergenic
974444607 4:61963409-61963431 TCTTGAGAGTGGAGGGTGGGAGG - Intronic
975299857 4:72776684-72776706 AATTGAGAGTAGAGGGTGGGAGG + Intergenic
975991060 4:80260953-80260975 AAGTGGGAATAGAGGATGGGGGG - Intergenic
976318356 4:83683603-83683625 ACTTGAGGGTGGAGGATGGGAGG + Intergenic
976332136 4:83844757-83844779 CCTAGGGAATAGAGTATGGTGGG + Intergenic
976661577 4:87545621-87545643 ACTTGAGAGTGGAGGGTGGGAGG - Intergenic
977082006 4:92542202-92542224 ACTTGGGAGATGAAGATGGGAGG + Intronic
977552383 4:98456200-98456222 ACTTGAGAGTAGAGGGTGGGAGG + Intergenic
977903624 4:102451184-102451206 ACTTGAGGGTGGAGGATGGGAGG + Intergenic
978252991 4:106655613-106655635 ACTTGAGAGTAGAGGGTGGGAGG + Intergenic
978559553 4:110018007-110018029 CTTTGGGAGGCCAGGATGGGGGG + Intergenic
979019459 4:115477721-115477743 ACTTGAGGGTAGAGCATGGGAGG + Intergenic
979233069 4:118368395-118368417 CCTTGGGAAGACAGGGTGGGAGG + Intergenic
979549989 4:121979743-121979765 CTTTGGGAGGATGGGATGGGAGG - Intergenic
980187074 4:129475540-129475562 CCATGGTAGTAGAGGATAGCTGG + Intergenic
980435983 4:132774434-132774456 CCTTGGGACTAGAGGAGGAATGG - Intergenic
980622320 4:135324156-135324178 CTTTGGGAGGCCAGGATGGGTGG + Intergenic
980833390 4:138158731-138158753 CTTTGGGAGGACAAGATGGGTGG - Intergenic
981079027 4:140619940-140619962 CCTTGAGGGTGGAGGGTGGGTGG - Intergenic
981275192 4:142891349-142891371 ACTTGAGAGTGGAGGGTGGGAGG - Intergenic
981834179 4:149036176-149036198 ACTTGAGGGTGGAGGATGGGAGG - Intergenic
982294171 4:153809229-153809251 CTTTGGGAGGACAAGATGGGTGG - Intergenic
982680677 4:158425328-158425350 CTTTGGGAGGCCAGGATGGGAGG - Intronic
982735421 4:159001500-159001522 ACTTGAGGGTAGAGGATGGGAGG - Intronic
983293154 4:165831983-165832005 ACTTGAGGGTGGAGGATGGGAGG - Intergenic
983486708 4:168340793-168340815 ACTTGAGTGTAGAGGGTGGGAGG - Intergenic
983696912 4:170543610-170543632 GCTGGGGGGTAGAGGGTGGGAGG + Intergenic
983874658 4:172862453-172862475 CCTTGGGAGGCCAAGATGGGTGG + Intronic
984516629 4:180749487-180749509 ACTTGAGGGTAGAGGGTGGGAGG - Intergenic
984629497 4:182045937-182045959 GCTTGGGAGGCCAGGATGGGAGG + Intergenic
984729851 4:183057804-183057826 CTTTGGGTGCAGAGGATGGGAGG - Intergenic
984822175 4:183891599-183891621 ACTTGGGAGGAAAGGGTGGGAGG + Intronic
985239178 4:187911842-187911864 CCTTGAGGGTGGAGGTTGGGAGG - Intergenic
985895378 5:2747685-2747707 GCCTGGGAGTGGAGGATGGTGGG - Intronic
986381024 5:7185834-7185856 ACTTGAGGGTAGAGGGTGGGAGG + Intergenic
987064597 5:14276603-14276625 CCTTGGGAGTTGGGAGTGGGAGG + Intronic
987115209 5:14721025-14721047 CCTTTGGAGCAGTGGGTGGGGGG + Intronic
987320930 5:16768782-16768804 GCTTGGGAGGAGAGGGTGGGAGG - Intronic
987757872 5:22120340-22120362 CTTGGGGAATGGAGGATGGGAGG - Intronic
988004065 5:25385070-25385092 ACTTGAGGGTAGAGGGTGGGAGG - Intergenic
988043793 5:25921513-25921535 CCTTGAGGGTGGAGGGTGGGAGG + Intergenic
988201867 5:28078247-28078269 ACTTGAGGGCAGAGGATGGGAGG - Intergenic
989538612 5:42592411-42592433 ACTTGGGGGTGGAGGATGGGAGG - Intronic
990215008 5:53521168-53521190 ACTTGAGGGTAGAGGATGGAAGG + Intergenic
990497304 5:56361440-56361462 ACTTGAGGGTGGAGGATGGGAGG - Intergenic
990751532 5:59021984-59022006 CCCTGGTAGCAGAGGATGGTGGG - Intronic
991933061 5:71774362-71774384 ACTTGAGGGTGGAGGATGGGAGG + Intergenic
992204073 5:74413217-74413239 CCTTTGAAGTTGAGGAGGGGTGG + Intergenic
992305304 5:75431208-75431230 ACTTGAGGGTGGAGGATGGGAGG - Intronic
992593322 5:78318692-78318714 CCTTGAGGGTGGAGGGTGGGAGG + Intergenic
992614122 5:78533460-78533482 CTGTGAGAGTAGGGGATGGGCGG + Intronic
992841063 5:80695575-80695597 CTTTGGGAGGCTAGGATGGGTGG - Intronic
992857991 5:80883601-80883623 CCTTGAGGGTGGAGGGTGGGAGG - Intergenic
993104040 5:83578327-83578349 ACTTGAGGGTGGAGGATGGGAGG + Intronic
993713738 5:91253606-91253628 CTTTGGGAGGACAGGGTGGGAGG + Intergenic
993868203 5:93219711-93219733 GCTTGGGAGAAGAGGAGAGGAGG - Intergenic
995778609 5:115752172-115752194 ACTTGAGAGTGGAGGGTGGGAGG - Intergenic
995862784 5:116659956-116659978 CCTTGTCAATACAGGATGGGAGG - Intergenic
996588749 5:125121492-125121514 ACTTGAGGGTAGAGGTTGGGAGG - Intergenic
996769288 5:127068958-127068980 TCTTTGGAGTTGAGGATGGAGGG - Intronic
996892160 5:128434288-128434310 CCTTGGGAGTATATTATGGCAGG - Intronic
997019657 5:129984178-129984200 ACTTGAGAGTACAGGTTGGGAGG - Intronic
997225790 5:132208540-132208562 CCATGGGACTTGAGGATGTGAGG - Intronic
997663576 5:135608740-135608762 CCTTGGGAGAAGAGGGAGGATGG - Intergenic
998307212 5:141090516-141090538 CTTTGGGAGTCCAAGATGGGTGG - Intergenic
998943647 5:147313157-147313179 CCTTGGAAGTGGAGGCTGCGGGG + Intronic
999071060 5:148744594-148744616 ACTTGAGGGTAGAGGGTGGGAGG + Intergenic
999231573 5:150065148-150065170 CCTTTGGTGGGGAGGATGGGAGG - Intronic
999761721 5:154706553-154706575 ACTTGAGAGTGGAGGGTGGGAGG + Intergenic
999834951 5:155359707-155359729 ACTTGAGGGTAGAGGATGGAAGG + Intergenic
1000037552 5:157460428-157460450 CCCTGGGAGGAGAGGATGCGAGG - Intronic
1001120273 5:168974644-168974666 TCTTGAGAGAAGAGGAGGGGTGG + Intronic
1001206276 5:169766217-169766239 GCTTGAGGGTAGAGGGTGGGAGG - Intronic
1001242353 5:170080338-170080360 CCTTGTGGGTGGAGGATGGATGG + Intronic
1001394701 5:171409051-171409073 CTTTGGGAGGAAAAGATGGGAGG - Intronic
1001503480 5:172257135-172257157 CCTTGAGGGCAGAGGATGGGAGG - Intronic
1001590152 5:172859368-172859390 CCATGGGAGTTGGGGGTGGGTGG - Intronic
1004793705 6:19057571-19057593 ACTCGGGGGTAGAGGGTGGGAGG + Intergenic
1005244913 6:23872644-23872666 ACTTGAGGGTAGAGGGTGGGAGG + Intergenic
1005283241 6:24297305-24297327 ACTTGAGGGTAGAGGGTGGGAGG + Intronic
1005630750 6:27705557-27705579 CTTTGGGAGTCCAGGGTGGGAGG + Intergenic
1005981777 6:30842056-30842078 CCCAGGCAGGAGAGGATGGGAGG + Intergenic
1006073609 6:31515316-31515338 CCTTGAGGGTGGAGGGTGGGAGG + Intergenic
1006268094 6:32942084-32942106 ACTTGAGGGTGGAGGATGGGAGG - Intronic
1006304399 6:33210355-33210377 CTTTGGGAGGTGAGGATGGGAGG + Intronic
1006706781 6:36027665-36027687 TCGTGAGAGAAGAGGATGGGAGG - Intronic
1006784418 6:36655959-36655981 CTTTGGGAGTACAAGGTGGGCGG + Intergenic
1006915094 6:37588688-37588710 CCTGGGGAGTTGAGAAGGGGTGG + Intergenic
1007230241 6:40343143-40343165 GCTGGGGAGGAGAGGTTGGGTGG + Intergenic
1007373024 6:41439287-41439309 CCGAGGGAGTAGAGGGTGAGAGG - Intergenic
1007715130 6:43851354-43851376 CCTGGGGAGTTGAGGATGGGTGG - Intergenic
1008098828 6:47369531-47369553 CCTTGGGAGGCCAAGATGGGTGG - Intergenic
1008164803 6:48123175-48123197 ACTTGAGAGTGGAGGATGGGAGG + Intergenic
1008502140 6:52193855-52193877 CTTTGGGAGGCCAGGATGGGAGG + Intergenic
1008987091 6:57557613-57557635 CCTTGAGGGTGGAGGGTGGGAGG + Intronic
1009175049 6:60450180-60450202 CCTTGAGGGTGGAGGGTGGGAGG + Intergenic
1009592002 6:65684887-65684909 ACTTGAGGGTGGAGGATGGGAGG - Intronic
1010401283 6:75449318-75449340 ACTTGGGGGGAAAGGATGGGAGG + Intronic
1010832200 6:80544281-80544303 CCATTAGGGTAGAGGATGGGAGG + Intergenic
1011003775 6:82621266-82621288 CCTTGGGAGGCCAAGATGGGCGG + Intergenic
1011407569 6:87031663-87031685 CCTTGGGAGCCTAAGATGGGAGG - Intergenic
1012585911 6:100922378-100922400 TCTTGAGAGTGGAGGGTGGGAGG + Intergenic
1012604612 6:101142770-101142792 TCTTGAGGGTGGAGGATGGGAGG - Intergenic
1013253878 6:108363369-108363391 ACTTGAGTGTAGAGGGTGGGAGG - Intronic
1013291263 6:108720722-108720744 CTTTGGGAGGCCAGGATGGGTGG - Intergenic
1013457670 6:110345775-110345797 ACTTGAGGGTGGAGGATGGGAGG + Intronic
1014335379 6:120127214-120127236 TCTTGAGGGTAGAGGCTGGGAGG - Intergenic
1014717284 6:124880562-124880584 ACTTGAAGGTAGAGGATGGGAGG + Intergenic
1014913815 6:127120949-127120971 CCCTGGGAGGAGAGGAGGCGGGG - Intronic
1015160704 6:130149707-130149729 ACTTGAGATTAGAGGGTGGGTGG + Intronic
1015230136 6:130905525-130905547 ACTTGGGAGGCTAGGATGGGAGG - Intronic
1015493833 6:133859211-133859233 ACTTGGGGGTAGAGGGTAGGAGG - Intergenic
1015981481 6:138843931-138843953 CCTTGGGAGGCCAGGGTGGGCGG - Intronic
1016472556 6:144389840-144389862 CTTTGGGAGGCCAGGATGGGCGG - Intronic
1016558069 6:145361951-145361973 CTTTGGGAGGCGAAGATGGGTGG + Intergenic
1016576983 6:145580665-145580687 ACTTTAGAGTAGAGGGTGGGAGG - Intronic
1016768249 6:147819322-147819344 ACTTGGGGGTGGAGGATAGGAGG + Intergenic
1017026729 6:150187448-150187470 CCTTAAGGGTAGAGGGTGGGAGG - Intronic
1017993999 6:159515362-159515384 CCTTGAGGGTGGAGGGTGGGAGG - Intergenic
1017995634 6:159529528-159529550 CTTTGGGAGTCCAGGGTGGGAGG + Intergenic
1018252409 6:161883894-161883916 CCTTGGGAGGCCAAGATGGGCGG - Intronic
1019183212 6:170205543-170205565 CCTTGAGGGTGGAGGGTGGGAGG + Intergenic
1019719132 7:2557744-2557766 CTTTGGGAGTCTAGGGTGGGTGG - Intergenic
1020081575 7:5288884-5288906 CCTGGTGGGTAAAGGATGGGAGG - Intronic
1020195814 7:6038184-6038206 CTTTGGGAGGAGAGGACAGGAGG + Intronic
1020410486 7:7886733-7886755 GCTTTAGAGTAGAGGATGGATGG - Intronic
1020433310 7:8135268-8135290 CTTTGGGAGGACAAGATGGGCGG - Intronic
1021419443 7:20428900-20428922 ACTTGAGAGTGGAGGGTGGGAGG + Intergenic
1021450956 7:20783961-20783983 CCTGGGGGGTGGAGGAGGGGAGG + Intronic
1022153402 7:27633548-27633570 CCTTGGGAGGCTAAGATGGGAGG + Intronic
1022160971 7:27710818-27710840 CTTTCGGAGGCGAGGATGGGAGG + Intergenic
1022203285 7:28138662-28138684 CCTTTGGAGAAGAAGAAGGGTGG - Intronic
1022984886 7:35642801-35642823 ACTTGAGAGTGGAGGGTGGGAGG + Intronic
1023304681 7:38813346-38813368 CCTAGGGATGAGAGGAGGGGAGG + Intronic
1023910390 7:44551421-44551443 CTTTGGGAGGAGAAGTTGGGAGG + Intergenic
1024375272 7:48630307-48630329 ACTTGAGGGTGGAGGATGGGAGG - Intronic
1025061123 7:55809256-55809278 CCTTGAGGGTGGAGGGTGGGAGG + Intronic
1025184886 7:56850039-56850061 ACTTGGGAGTCTAGGGTGGGAGG + Intergenic
1025197332 7:56943279-56943301 CCTGGTGGGTAAAGGATGGGAGG + Intergenic
1025674616 7:63633660-63633682 CCTGGTGGGTAAAGGATGGGAGG - Intergenic
1025687048 7:63726925-63726947 ACTTGGGAGTCTAGGGTGGGAGG - Intergenic
1026033229 7:66813302-66813324 CAGTGTCAGTAGAGGATGGGTGG + Intergenic
1026407417 7:70081305-70081327 CTTTGGGAGTCCAGGAAGGGCGG + Intronic
1026460246 7:70608346-70608368 CTTTGGGAGTCCAGGGTGGGAGG - Intronic
1026476441 7:70739966-70739988 CCTTGGTAGTGGATGAGGGGAGG - Intronic
1026866774 7:73828981-73829003 CTTTGGGAGGCCAGGATGGGAGG - Exonic
1026976318 7:74501043-74501065 CTTGGGGAGAAGAGGAGGGGAGG + Intronic
1027356846 7:77365381-77365403 TCTTGAGAGTGGAGGGTGGGAGG - Intronic
1028758381 7:94464720-94464742 ACTTGAGTGTGGAGGATGGGAGG - Intergenic
1029279193 7:99425696-99425718 CCTTGGGAGTTTTAGATGGGAGG + Intronic
1029283820 7:99452924-99452946 CCTGTGGAGTGGAGGTTGGGAGG + Intronic
1030043349 7:105472304-105472326 GCCTGGGAGTAGAGCCTGGGAGG - Intronic
1030151397 7:106409178-106409200 CTTTGGGAGGGCAGGATGGGAGG + Intergenic
1030699975 7:112627423-112627445 ACTTGAGAGTGGAGGGTGGGAGG - Intergenic
1030711155 7:112750938-112750960 ACTTGAGGGTAGAGGGTGGGAGG + Intergenic
1030718950 7:112846359-112846381 ACTTGAGGGTAGAGGATGGGAGG + Intronic
1030982770 7:116206269-116206291 ACTTGAGGGTAGAGGGTGGGAGG + Intergenic
1031396498 7:121280483-121280505 GCTGGGGATTAGAGGAAGGGTGG + Intronic
1031465462 7:122104771-122104793 ACTTGAGGGTGGAGGATGGGAGG + Intronic
1033160020 7:138987171-138987193 CTTTGGGAGGCCAGGATGGGTGG + Intergenic
1033233480 7:139620004-139620026 CTTTGGGAGTTCAGGGTGGGAGG - Intronic
1033389769 7:140915677-140915699 CTTTGGGAGGCCAGGATGGGTGG - Intronic
1033493437 7:141868105-141868127 ACTTGAGGGTGGAGGATGGGAGG + Intergenic
1033710841 7:143941952-143941974 CCTTGAGAGGAGAGGACGGGAGG - Intergenic
1034506965 7:151500043-151500065 CTTTGGGAGGACAGAATGGGCGG - Intronic
1035459625 7:159030935-159030957 CCTTGGGGGCAGAGGCTGGAGGG + Intronic
1035599979 8:891627-891649 TTCTGGGAGTAGAGGATGGGTGG + Intergenic
1036376709 8:8206775-8206797 CCTTGGGGATAAAGGAGGGGAGG - Intergenic
1036641291 8:10585663-10585685 CCTTGGCAGCTGAGGATGGGAGG - Intergenic
1036852829 8:12216363-12216385 CCTTGGGGATAAAGGAGGGGAGG + Intergenic
1036874199 8:12458885-12458907 CCTTGGGGATAAAGGAGGGGAGG + Intergenic
1037052122 8:14387293-14387315 CTTTGGGAGACCAGGATGGGAGG - Intronic
1037061498 8:14516294-14516316 CCTTGAGGGTGGAGGGTGGGAGG - Intronic
1037524863 8:19714914-19714936 ACTTGAGGGTAGAGGATGGAAGG - Intronic
1037867886 8:22461989-22462011 CATTGGGAGTCTAGGATGGGAGG + Intronic
1038855384 8:31325522-31325544 CCTTGGGAGGCCAGGGTGGGAGG - Intergenic
1039294695 8:36137682-36137704 CCTTGGGAGGCGAAGGTGGGAGG + Intergenic
1039378496 8:37061690-37061712 GCTTGGGAGATGAGGGTGGGAGG + Intergenic
1039784812 8:40824931-40824953 TATTGGGAGCAGAGGATGAGAGG - Intronic
1039831797 8:41221280-41221302 CCTCGGGAGGCCAGGATGGGAGG - Intergenic
1041226232 8:55701363-55701385 CTTTGGGAGGACAAGATGGGAGG + Intronic
1041507849 8:58621095-58621117 GCTTGAGGGTGGAGGATGGGAGG - Intronic
1041521432 8:58760844-58760866 ACTTGAGGGTGGAGGATGGGCGG - Intergenic
1041895007 8:62914339-62914361 ACTTGAGGGTAGAGGATGGGAGG + Intronic
1042079469 8:65035307-65035329 ACTTGAGGGTGGAGGATGGGAGG - Intergenic
1042401023 8:68347108-68347130 ACTTGAGAGTGGAGGGTGGGAGG - Intronic
1042583151 8:70304736-70304758 CCTTGGGAGGCCAAGATGGGTGG - Intronic
1042651349 8:71045575-71045597 CCCGGGGAGAAGAGGATGGGAGG + Intergenic
1043337088 8:79189464-79189486 GCTTGAGGGTAGAGGATGGGAGG + Intergenic
1043971391 8:86533133-86533155 CTTTGGGAGTATGAGATGGGAGG - Intronic
1044435656 8:92159635-92159657 ACTTGAGAGTGGAGGGTGGGAGG + Intergenic
1045229473 8:100288815-100288837 CTTTGGGAGGCCAGGATGGGCGG + Intronic
1045839982 8:106568412-106568434 TATTGGGAGGAGAGGATGGAAGG - Intronic
1047940205 8:129822067-129822089 GCTTGGGAGTGGAGGAGGGAAGG + Intergenic
1048236578 8:132696884-132696906 ACTTGAGGGTAGAGGGTGGGAGG + Intronic
1048679674 8:136826013-136826035 CCTTGAGCTTAGAAGATGGGAGG + Intergenic
1048681477 8:136846243-136846265 CCTTGGGAGTAGAGGGGAGAGGG + Intergenic
1048716102 8:137272030-137272052 GCTTGGGGGCAGAGGGTGGGAGG + Intergenic
1049785355 8:144448221-144448243 CTGTGGGAGTTCAGGATGGGAGG - Intergenic
1050634508 9:7597104-7597126 CCTTGGGAGTCCAAGGTGGGTGG + Intergenic
1050891085 9:10825340-10825362 ACCTGGGAGTGGAGGGTGGGAGG - Intergenic
1051072146 9:13183417-13183439 CCTTAGGAGGAGATGATGGAAGG + Exonic
1051129992 9:13850029-13850051 ACTTGAGGGTGGAGGATGGGAGG + Intergenic
1051216049 9:14798915-14798937 CTTTGGGAGGCCAGGATGGGTGG - Intronic
1051348584 9:16175723-16175745 CATTGGCAGAAGAGGATGGATGG + Intergenic
1051768037 9:20545773-20545795 CTTTGGGAGGTCAGGATGGGAGG + Intronic
1052286822 9:26795610-26795632 ACTTGAGAGTAAAGGGTGGGAGG + Intergenic
1052626822 9:30986034-30986056 ACTTGAGGGTAGAGGGTGGGAGG + Intergenic
1053070271 9:35097007-35097029 CCTTCGGAGTGGAGGAGGGGAGG + Intergenic
1053517429 9:38742915-38742937 ATTTGGGAGTAGATGAAGGGAGG + Intergenic
1053750525 9:41249800-41249822 CTTTGGGAGGCCAGGATGGGGGG - Intergenic
1055222134 9:73948358-73948380 CTTTGGGAGTCGGAGATGGGCGG - Intergenic
1055387805 9:75782563-75782585 ACTTGAGAGTGGAGGGTGGGAGG - Intergenic
1056418199 9:86398168-86398190 CTTTGGGAGGACAAGATGGGTGG - Intergenic
1057141651 9:92730024-92730046 CCTGGGGTGTACACGATGGGAGG - Intronic
1057353390 9:94317982-94318004 CCTTGTGAGTGGATGGTGGGAGG + Intergenic
1057353633 9:94318944-94318966 CCTGGGGAGGAGAGGTTGGCCGG + Exonic
1057654118 9:96938648-96938670 CCTGGGGAGGAGAGGTTGGCCGG - Exonic
1057654361 9:96939610-96939632 CCTTGTGAGTGGATGGTGGGAGG - Intronic
1058909028 9:109504295-109504317 TCTTGGGACTAGAGGATGAAGGG - Intergenic
1059003328 9:110374148-110374170 ACTTGAGGGTAGAGGGTGGGAGG - Intronic
1059083973 9:111280258-111280280 CCTTGAGGGTGGAGGGTGGGAGG - Intergenic
1059868964 9:118549601-118549623 ACTTGAAAGTAGAGTATGGGAGG + Intergenic
1060340704 9:122773998-122774020 ACTTGAGAGTGGAGGTTGGGAGG + Intergenic
1060751221 9:126170713-126170735 CCCAGGAAGGAGAGGATGGGAGG + Intergenic
1061059674 9:128244197-128244219 CTTTGGGATGTGAGGATGGGGGG + Intronic
1061616200 9:131780884-131780906 ACTTGAGGGTAGAGGGTGGGCGG + Intergenic
1061765546 9:132878889-132878911 ACTTGGGAGGCGAGGGTGGGTGG - Exonic
1062299160 9:135854916-135854938 CCTTGAGGGTGGAGGGTGGGAGG - Intronic
1062691353 9:137843375-137843397 ACTTAGGAGTGGAGGGTGGGAGG - Intronic
1185887830 X:3798418-3798440 CCTTGGGAGTCCAAGGTGGGTGG - Intergenic
1185889483 X:3811522-3811544 CCTCGGGAGGGGAGGAGGGGAGG + Intergenic
1186177904 X:6944490-6944512 GCTTGGGAACAGGGGATGGGTGG - Intergenic
1186214297 X:7282442-7282464 CCTTGGGAGGCCAAGATGGGAGG - Intronic
1186355643 X:8787163-8787185 CCTTGGGAGTCTGAGATGGGAGG + Intergenic
1186361513 X:8846780-8846802 CTTTGGGAGGCGAAGATGGGCGG + Intergenic
1186731507 X:12415375-12415397 ACTGGGGAGGAGAGGATGGATGG - Intronic
1186890715 X:13956774-13956796 ACTTGAGGGTGGAGGATGGGAGG + Intergenic
1187053639 X:15718827-15718849 ACTTGAGGGTAGAGGGTGGGAGG + Intronic
1187195349 X:17078082-17078104 CCTAAGGAATAGAAGATGGGAGG + Intronic
1187301263 X:18052393-18052415 CCTTGAGGGTGGAGGATGGGAGG - Intergenic
1187425127 X:19170699-19170721 CCTTGGGAGGCCAAGATGGGAGG + Intergenic
1187544341 X:20232889-20232911 CTTTGGGAGGCGAAGATGGGTGG + Intronic
1187586084 X:20663400-20663422 CACTGGGAGTGGAGGATGGGGGG - Intergenic
1188757160 X:33976066-33976088 ACTTGAGGGTGGAGGATGGGAGG + Intergenic
1188806429 X:34596285-34596307 ACTTGAGGGTAGGGGATGGGAGG - Intergenic
1188816675 X:34723534-34723556 ACTTGAGGGTTGAGGATGGGAGG - Intergenic
1189638734 X:43043917-43043939 CCTTGAGGGTAGAGGGTGGGGGG - Intergenic
1189914501 X:45843496-45843518 CCTTGGGGATAGAAGAGGGGAGG + Intergenic
1190291931 X:48998915-48998937 GAGTGTGAGTAGAGGATGGGAGG + Intronic
1190447934 X:50549240-50549262 ACTTGAGGGTAGAGGGTGGGAGG - Intergenic
1190515235 X:51216829-51216851 ACTTGAGAGTGGAGGGTGGGAGG - Intergenic
1190727427 X:53198771-53198793 CCCTGGAGGTGGAGGATGGGCGG - Exonic
1190794577 X:53729107-53729129 CTTTGGGAGGTGAGGTTGGGGGG - Intergenic
1190829436 X:54046754-54046776 CTTTGGGAGGTCAGGATGGGAGG + Intronic
1190914886 X:54804023-54804045 CCTGGGGATCAGAGGATAGGAGG - Intergenic
1191738373 X:64411048-64411070 ACTTGAGGGTAGAGGGTGGGAGG - Intergenic
1191926423 X:66315750-66315772 ACTTGAGAGTAGAGGGTGGGAGG + Intergenic
1192339002 X:70246749-70246771 ACTTGAGAGTGGAGGGTGGGAGG + Intergenic
1192696970 X:73427263-73427285 ACTTGAGATGAGAGGATGGGAGG + Intergenic
1192880653 X:75279795-75279817 ACTTGGGAGGAAAGGGTGGGAGG - Intronic
1193456006 X:81732391-81732413 ACTTGAGAGTGGAGGGTGGGAGG + Intergenic
1193631233 X:83890612-83890634 ACTTGAGAGTGGAGGGTGGGGGG - Intergenic
1193722192 X:85000274-85000296 ACTTGAGGGTAGAGGGTGGGAGG - Intergenic
1193998987 X:88403500-88403522 ACTTGGGTGTGGAGGGTGGGAGG - Intergenic
1194484208 X:94467075-94467097 ACTTGAGGGTAGAGGGTGGGAGG + Intergenic
1195138362 X:101932909-101932931 CTTTGAGAGGAGAGGTTGGGGGG - Intergenic
1195209255 X:102636343-102636365 ACTTGAGAGTTGAGGGTGGGAGG + Intergenic
1195275901 X:103280285-103280307 ACTTGAGGGTGGAGGATGGGAGG - Intergenic
1195833089 X:109082342-109082364 ACTTGAGGGTGGAGGATGGGAGG - Intergenic
1196040429 X:111197073-111197095 ACTTGAGAGTGGAGGGTGGGAGG - Intronic
1196487754 X:116233305-116233327 ACTTGAGAGTGGAGGCTGGGAGG - Intergenic
1196574504 X:117302409-117302431 CCTTGGGAGTTGAGTATTGCTGG + Intergenic
1196579939 X:117367067-117367089 ACTTGAAAGTGGAGGATGGGAGG - Intergenic
1196771334 X:119297340-119297362 CCTTGAGAGTGGAGGTTGGGAGG + Intergenic
1197424894 X:126283642-126283664 ACTGGAGGGTAGAGGATGGGAGG - Intergenic
1197935816 X:131739452-131739474 CTTTGGGAGTCCAAGATGGGAGG - Intergenic
1197950058 X:131885041-131885063 CCTTGGGGGTGGAGCATGGGAGG - Intergenic
1198404011 X:136294640-136294662 CCTTGGGAGGATGAGATGGGTGG + Intergenic
1198423679 X:136494650-136494672 CCTTGAGATTATAGGATGTGGGG + Intergenic
1198528110 X:137522491-137522513 ACTTGAGGGTAGAGGTTGGGAGG - Intergenic
1198751449 X:139940156-139940178 CTTTGGGAGTCCAAGATGGGTGG + Intronic
1198895187 X:141446297-141446319 ACTTGAGGGTAGAGGATGGAAGG - Intergenic
1199338467 X:146647205-146647227 ACTTGAGGGTAGAGGGTGGGAGG - Intergenic
1199681559 X:150228136-150228158 ATGTGGGAGTGGAGGATGGGAGG - Intergenic
1199858110 X:151776911-151776933 CTGTGGGAGCAGAGGGTGGGTGG - Intergenic
1200070517 X:153526868-153526890 CCTTGGGAGTACAGGCTGGGGGG - Intronic
1200383269 X:155862125-155862147 ACTTGAGGGTAGAGGGTGGGAGG - Intergenic
1201587767 Y:15580237-15580259 ACTTGAGAGTGGAGGGTGGGAGG + Intergenic