ID: 1069622142

View in Genome Browser
Species Human (GRCh38)
Location 10:69844240-69844262
Sequence GTGTGGCTGTCCAGGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069622135_1069622142 15 Left 1069622135 10:69844202-69844224 CCTGAAAAGTTATCTGTGCTTGA 0: 1
1: 0
2: 2
3: 22
4: 228
Right 1069622142 10:69844240-69844262 GTGTGGCTGTCCAGGGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069622142 Original CRISPR GTGTGGCTGTCCAGGGAGGA TGG Intronic
No off target data available for this crispr