ID: 1069622963

View in Genome Browser
Species Human (GRCh38)
Location 10:69849227-69849249
Sequence GCAGCCACTTCTGTCTCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069622963_1069622978 23 Left 1069622963 10:69849227-69849249 CCATCAGAGACAGAAGTGGCTGC No data
Right 1069622978 10:69849273-69849295 CTTCCTCCAGGAGGGGCCTGGGG No data
1069622963_1069622973 15 Left 1069622963 10:69849227-69849249 CCATCAGAGACAGAAGTGGCTGC No data
Right 1069622973 10:69849265-69849287 CTTTCCTGCTTCCTCCAGGAGGG No data
1069622963_1069622977 22 Left 1069622963 10:69849227-69849249 CCATCAGAGACAGAAGTGGCTGC No data
Right 1069622977 10:69849272-69849294 GCTTCCTCCAGGAGGGGCCTGGG No data
1069622963_1069622979 24 Left 1069622963 10:69849227-69849249 CCATCAGAGACAGAAGTGGCTGC No data
Right 1069622979 10:69849274-69849296 TTCCTCCAGGAGGGGCCTGGGGG No data
1069622963_1069622972 14 Left 1069622963 10:69849227-69849249 CCATCAGAGACAGAAGTGGCTGC No data
Right 1069622972 10:69849264-69849286 CCTTTCCTGCTTCCTCCAGGAGG No data
1069622963_1069622976 21 Left 1069622963 10:69849227-69849249 CCATCAGAGACAGAAGTGGCTGC No data
Right 1069622976 10:69849271-69849293 TGCTTCCTCCAGGAGGGGCCTGG No data
1069622963_1069622969 11 Left 1069622963 10:69849227-69849249 CCATCAGAGACAGAAGTGGCTGC No data
Right 1069622969 10:69849261-69849283 ATCCCTTTCCTGCTTCCTCCAGG No data
1069622963_1069622974 16 Left 1069622963 10:69849227-69849249 CCATCAGAGACAGAAGTGGCTGC No data
Right 1069622974 10:69849266-69849288 TTTCCTGCTTCCTCCAGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069622963 Original CRISPR GCAGCCACTTCTGTCTCTGA TGG (reversed) Intronic