ID: 1069623138

View in Genome Browser
Species Human (GRCh38)
Location 10:69850080-69850102
Sequence CTGGGTGAGCTGGAGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069623127_1069623138 -1 Left 1069623127 10:69850058-69850080 CCCTGGAGCCATAAAACTCCCAC 0: 1
1: 0
2: 0
3: 10
4: 146
Right 1069623138 10:69850080-69850102 CTGGGTGAGCTGGAGGTGGAGGG No data
1069623128_1069623138 -2 Left 1069623128 10:69850059-69850081 CCTGGAGCCATAAAACTCCCACT 0: 1
1: 0
2: 1
3: 12
4: 173
Right 1069623138 10:69850080-69850102 CTGGGTGAGCTGGAGGTGGAGGG No data
1069623131_1069623138 -9 Left 1069623131 10:69850066-69850088 CCATAAAACTCCCACTGGGTGAG 0: 1
1: 0
2: 0
3: 8
4: 106
Right 1069623138 10:69850080-69850102 CTGGGTGAGCTGGAGGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069623138 Original CRISPR CTGGGTGAGCTGGAGGTGGA GGG Intronic
No off target data available for this crispr