ID: 1069624100

View in Genome Browser
Species Human (GRCh38)
Location 10:69856790-69856812
Sequence GACCTAGAGATATCTTCTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 116}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069624100_1069624106 4 Left 1069624100 10:69856790-69856812 CCTTGAGAAGATATCTCTAGGTC 0: 1
1: 0
2: 0
3: 15
4: 116
Right 1069624106 10:69856817-69856839 GGGAGGATCTCACTGTTTCTGGG No data
1069624100_1069624108 19 Left 1069624100 10:69856790-69856812 CCTTGAGAAGATATCTCTAGGTC 0: 1
1: 0
2: 0
3: 15
4: 116
Right 1069624108 10:69856832-69856854 TTTCTGGGAGACTCAGTCAAGGG No data
1069624100_1069624107 18 Left 1069624100 10:69856790-69856812 CCTTGAGAAGATATCTCTAGGTC 0: 1
1: 0
2: 0
3: 15
4: 116
Right 1069624107 10:69856831-69856853 GTTTCTGGGAGACTCAGTCAAGG No data
1069624100_1069624105 3 Left 1069624100 10:69856790-69856812 CCTTGAGAAGATATCTCTAGGTC 0: 1
1: 0
2: 0
3: 15
4: 116
Right 1069624105 10:69856816-69856838 TGGGAGGATCTCACTGTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069624100 Original CRISPR GACCTAGAGATATCTTCTCA AGG (reversed) Intronic
904856656 1:33502968-33502990 GACCCAGAGCTTTCTCCTCAGGG - Intergenic
905361828 1:37426142-37426164 GGCCTGGAGATAACTTCTCTAGG - Intergenic
908587358 1:65584938-65584960 GACCTAGATAAATCTTATCAAGG - Intronic
908856102 1:68431441-68431463 GATCTAGAGAAAACTTCACACGG - Intronic
910779480 1:90913342-90913364 GACATATACATAACTTCTCAAGG - Intergenic
911778845 1:101849638-101849660 CACTTAGAGGTATATTCTCACGG + Intronic
912864567 1:113245772-113245794 GAGGGAGAGATATCCTCTCAAGG + Intergenic
917240937 1:172948062-172948084 GACCTAGAGACATCCTATGATGG - Intergenic
917620869 1:176794471-176794493 TAGCTAGTGATATCTTTTCAGGG - Intronic
920526817 1:206673334-206673356 TTCCTAGAGAGAGCTTCTCACGG + Intronic
1063778660 10:9294747-9294769 CACCTAAATATATATTCTCATGG - Intergenic
1063991563 10:11570277-11570299 GGCGTAGAGATATATCCTCAAGG - Intronic
1065643643 10:27811968-27811990 GACTTAGAGAGATCATCCCAAGG - Intergenic
1066290197 10:34007321-34007343 GAGCTAGAAATATATTCTCAAGG - Intergenic
1067273377 10:44811950-44811972 GACCAAGAGATTTATTCTCAGGG + Intergenic
1069624100 10:69856790-69856812 GACCTAGAGATATCTTCTCAAGG - Intronic
1069704080 10:70446594-70446616 GACTTAGAGCTAGATTCTCAGGG + Intronic
1071117482 10:82238980-82239002 GTCATAAAGATATTTTCTCATGG + Intronic
1071117540 10:82239709-82239731 GTCATAAAGATATTTTCTCATGG + Intronic
1071964996 10:90843462-90843484 GACCTAGTAATATCTAATCAAGG + Intronic
1075742738 10:124705756-124705778 GACCTAGGTCTATCTGCTCAAGG + Intronic
1075986265 10:126788149-126788171 GACCTGGAGATGGCATCTCATGG - Intergenic
1078089770 11:8257699-8257721 GTCCTAGAGACCTCTTCCCAAGG + Intronic
1078943294 11:16033482-16033504 GACCTGGAGAAATCATTTCATGG + Intronic
1080947038 11:36984841-36984863 TTCATAGAGATTTCTTCTCAGGG + Intergenic
1087849046 11:103007561-103007583 GACCTAGAAAAATCTCCTTATGG + Intergenic
1087852781 11:103051743-103051765 GAGCTCAAGTTATCTTCTCAAGG + Intergenic
1088002840 11:104903468-104903490 GAGGTAGAAATATCTTGTCATGG + Intergenic
1088006269 11:104944768-104944790 GAGGTAGAAATATCTTGTCATGG + Exonic
1088675242 11:112186416-112186438 GACCTAAAGATATCTGTCCAAGG - Intronic
1097453093 12:59760304-59760326 GACCTAGAGATGTGTTCACATGG - Intronic
1098915088 12:76249051-76249073 GACTTAGAGACACCTTCTCTAGG - Intergenic
1099256524 12:80321160-80321182 GAACTAGAGAAATCTTCTAGAGG - Intronic
1099506834 12:83488318-83488340 GACATAGAAATGACTTCTCATGG + Intergenic
1099874994 12:88393118-88393140 TACCTGGAGATAGCTTCTCCAGG + Intergenic
1100030167 12:90177564-90177586 GACCTACAGATATTTTCACAAGG - Intergenic
1101014303 12:100483683-100483705 GACCTGGAAATATATTCTTAAGG - Intronic
1105488638 13:20863799-20863821 TGCCTAGAGATAATTTCTCATGG - Intronic
1106412161 13:29518050-29518072 GAGCAAGAGAGATCCTCTCAGGG - Intronic
1108279388 13:48846292-48846314 GACCTAGATATAGCTTCACGAGG + Intergenic
1108301229 13:49078377-49078399 TGCCTAAAAATATCTTCTCATGG - Intronic
1108799654 13:54079832-54079854 GTCTTAGACATATCCTCTCATGG - Intergenic
1108848382 13:54701196-54701218 GACCTTGAGAGTTCTGCTCATGG - Intergenic
1112951263 13:104999450-104999472 AACCTATAGATATCTCCTTAGGG - Intergenic
1116296925 14:43123036-43123058 GGCCTTGATATATCTTCTTATGG - Intergenic
1118083215 14:62386373-62386395 GAGCAAGACACATCTTCTCACGG - Intergenic
1122801185 14:104230419-104230441 GACCCAGAGAGATCTGGTCACGG + Intergenic
1124007052 15:25802801-25802823 GACCTCGAGATAGATTCTCCTGG - Intronic
1127649089 15:60988780-60988802 GACCTAGATTTATCTACTCCAGG + Intronic
1130622385 15:85477239-85477261 GGCATAGAGAGATTTTCTCAGGG + Intronic
1132296809 15:100742316-100742338 GTCCTAGAGATTTCTTCTTTGGG + Intergenic
1135661791 16:24303287-24303309 TACCTAGAAAGGTCTTCTCATGG + Intronic
1143110647 17:4550929-4550951 CACCTAGAGGTAACTTCTCAGGG + Intronic
1144478160 17:15607042-15607064 GTACTATAGATATCTTCCCATGG - Intronic
1144920135 17:18756664-18756686 GTACTATAGATATCTTCCCATGG + Intronic
1150021439 17:61618186-61618208 AACCTAAATGTATCTTCTCATGG + Intergenic
1154949589 18:21196139-21196161 GACCTAGAGATATATTTTGAAGG - Intergenic
1158066334 18:53413846-53413868 GACCTTGACATATCTTGTCAAGG + Intronic
1158226521 18:55206960-55206982 GACTTAGACATATAGTCTCAGGG + Intergenic
1158609585 18:58927127-58927149 GGCCTAGAGATTTCTTTTCTAGG + Intronic
1158661260 18:59390319-59390341 GACTTAAACATATCTTTTCAGGG - Intergenic
1159595723 18:70381152-70381174 AACCTACATATCTCTTCTCAAGG - Intergenic
1159969634 18:74633547-74633569 GACCTAAAGGTAACATCTCACGG + Exonic
1160132425 18:76238201-76238223 GACTATGATATATCTTCTCATGG - Intergenic
1168185113 19:54695595-54695617 GACTTAGAGGTTTGTTCTCAGGG + Intronic
928469157 2:31556350-31556372 GACATAGAGATATCTTTTTGGGG - Intronic
930284933 2:49415692-49415714 GACCCAGAGAGATATTCTAAGGG + Intergenic
933201548 2:79455939-79455961 GACCTAGAAATATCTTACAAAGG + Intronic
934591398 2:95553324-95553346 GACTTAGAAATATATTTTCAGGG + Intergenic
934745595 2:96757598-96757620 GACCATGAGACATCTTTTCAGGG - Intergenic
935334429 2:102002254-102002276 GACATAGACATATTTTCTCCTGG - Intronic
937965901 2:127510125-127510147 GTCCTATAGATATTTCCTCATGG - Intronic
943456100 2:188109092-188109114 GATGTAGAGATATATTTTCAAGG + Intergenic
948989477 2:241545532-241545554 GACCTAGAAATAAATTGTCAAGG + Intergenic
1169822250 20:9724482-9724504 GCCCTAGAAATATGTTCACATGG + Intronic
1172631871 20:36384017-36384039 GACCTGGAAGTAGCTTCTCAGGG + Intronic
1176012052 20:62903206-62903228 GACCTACTGATATCTTAGCAGGG + Intronic
1178945069 21:36940259-36940281 TTCCTAAAGATACCTTCTCAGGG + Intronic
1179271194 21:39852394-39852416 CACCTAGAACTGTCTTCTCAAGG + Intergenic
952696375 3:36269206-36269228 GACCCAGAGCTACCTTCTTAAGG + Intergenic
956392755 3:68791182-68791204 GACTTAAACATATCTTCTGATGG - Intronic
956894485 3:73645817-73645839 GACATAGAATTATCTCCTCATGG + Intergenic
958550167 3:95602033-95602055 GACCAAGAGTCATCTTCTTATGG - Intergenic
962285320 3:134080972-134080994 GACCTTCAGACATTTTCTCAAGG - Intronic
970052233 4:11927709-11927731 GAAGTAGAAATATCTTCTCTGGG + Intergenic
972236279 4:37137717-37137739 GACCCAGAGATATTTTCAAATGG - Intergenic
973904749 4:55517725-55517747 GGCCTAGAGATATCTTTTTGGGG + Intronic
977063849 4:92288611-92288633 GCCCTGGAGATATTTTCCCATGG + Intergenic
981383776 4:144103223-144103245 GACCTAGAGTTTTTTTCTCAAGG - Intergenic
982308667 4:153960752-153960774 GGTCTATAGATACCTTCTCAAGG + Intergenic
986592749 5:9388555-9388577 TACCTAGAGATGTTTCCTCAGGG + Intronic
987806142 5:22771164-22771186 GTCATAGAACTATCTTCTCAAGG - Intronic
991590731 5:68248901-68248923 AACCAAGAGATATTTTCTGAAGG + Intronic
992950017 5:81849735-81849757 GACCTGGAGATTTCTTCTAATGG - Intergenic
997169979 5:131708147-131708169 TGCCTAGAGATACCTTCTCTAGG + Intronic
999525511 5:152401957-152401979 GACTTGGAAATATCATCTCAAGG - Intronic
1000649239 5:163795758-163795780 GAATTAGACATATCTTCTCATGG - Intergenic
1000954409 5:167525378-167525400 GACCTATAAATAACTTCTCTAGG - Intronic
1003799658 6:9649371-9649393 GAGCTAGAGATTTTCTCTCAGGG + Intronic
1005095148 6:22106307-22106329 GACCTGATGATATCATCTCAAGG - Intergenic
1006707576 6:36034568-36034590 AACTTAGGGATGTCTTCTCATGG + Intronic
1014060435 6:117065232-117065254 GACTTCAAGATATCTTTTCAGGG + Intergenic
1014316292 6:119869528-119869550 GACCTGGAGATATTTACTGATGG + Intergenic
1017128567 6:151089172-151089194 GACCTAGAGAGTTCATTTCAGGG + Intronic
1019464662 7:1181077-1181099 GACTTAGAGATTTATTCTGAAGG + Intergenic
1020398464 7:7745919-7745941 GACCGAGACTTACCTTCTCATGG + Intronic
1021251685 7:18335378-18335400 GACCCAGAGATCCCATCTCATGG + Intronic
1022593490 7:31688778-31688800 GACCAAGAGATATGATTTCAGGG - Intronic
1022865696 7:34417510-34417532 GACCTAGAGAGATCAACTCAGGG + Intergenic
1033225312 7:139557710-139557732 GACCTAGAGATCTCTGTACATGG + Intergenic
1046178272 8:110607727-110607749 CAACAAGAGATGTCTTCTCATGG + Intergenic
1047566630 8:126050858-126050880 GGCCTAGAGTTCTCTTATCAGGG + Intergenic
1048491849 8:134901563-134901585 GTCCTGGGGACATCTTCTCATGG + Intergenic
1050571690 9:6947095-6947117 GACCTAGAAATGTATTCACATGG - Intronic
1050773032 9:9227381-9227403 GACCTGGAGATATTTTCTCCAGG - Intronic
1052042480 9:23754865-23754887 GACAGAGAGACATCTTCCCATGG - Intronic
1052726573 9:32235117-32235139 GACCTAAAGATTTCTTCTTGAGG - Intergenic
1052746872 9:32449712-32449734 GAACTAGAAATAGCTTCTCAGGG - Intronic
1052923903 9:33997136-33997158 CTCCTAGACATATTTTCTCAAGG + Intronic
1056313651 9:85368181-85368203 GACCAAGACAAATCTTCTCCTGG + Intergenic
1057671630 9:97095656-97095678 GACCTACAGTTTTCTTCTTATGG - Intergenic
1062312312 9:135945485-135945507 GACCCAGAGATATCTGCTGAGGG + Intronic
1186403440 X:9280635-9280657 GAGCTGGAGATGTCTTCTGAAGG + Intergenic
1188806153 X:34592631-34592653 GACCTAAAGCTATTTTTTCAAGG + Intergenic
1189972977 X:46436698-46436720 GACCTAGAGAAATCTTTTGCTGG - Intergenic
1192552868 X:72068034-72068056 GGTCTAGAGATACCTTCCCAGGG - Intergenic
1192723249 X:73722595-73722617 GTCTTAGGGAGATCTTCTCATGG + Intergenic
1195391955 X:104371646-104371668 TATCTATAGATATTTTCTCATGG + Intergenic
1195613409 X:106894340-106894362 GGCTTAGAGACATTTTCTCATGG + Intronic
1197710658 X:129664723-129664745 GACATAGACATATCTTTTCGGGG + Intergenic
1199903867 X:152205172-152205194 GACTTAAACATATCTTTTCAGGG + Intronic
1201918997 Y:19213739-19213761 GACTTTGAGAGATCTGCTCATGG - Intergenic