ID: 1069626817

View in Genome Browser
Species Human (GRCh38)
Location 10:69873228-69873250
Sequence GTATAATCCATGTCTAAAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 163}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069626817_1069626823 28 Left 1069626817 10:69873228-69873250 CCCCTTTTAGACATGGATTATAC 0: 1
1: 0
2: 0
3: 9
4: 163
Right 1069626823 10:69873279-69873301 CTAAAATTCATGCCTAGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069626817 Original CRISPR GTATAATCCATGTCTAAAAG GGG (reversed) Intronic
911114687 1:94235092-94235114 GTATAATCCTTTTTTATAAGAGG - Intronic
911937773 1:104002143-104002165 ATATAATTCATGTCTAACAGGGG + Intergenic
913011584 1:114688729-114688751 GCATCATCAATTTCTAAAAGAGG + Exonic
916140036 1:161688582-161688604 GCATAATCCATGGGTCAAAGAGG - Intergenic
916379300 1:164190850-164190872 GTATATTCCATGGCAAAAATGGG + Intergenic
918894418 1:190321386-190321408 TTATAAACCATGCATAAAAGAGG + Intronic
919006974 1:191910341-191910363 GTCTCAGCCATGGCTAAAAGGGG - Intergenic
922669896 1:227501661-227501683 GCAAAAGCCAAGTCTAAAAGCGG - Intergenic
923088732 1:230722128-230722150 GCTTAAGCCATGGCTAAAAGGGG + Intergenic
1062992629 10:1834579-1834601 GTATAAGACATGTTTAAATGTGG - Intergenic
1066080293 10:31924316-31924338 GTACAATCCATCTCTAAAATAGG + Intronic
1067284546 10:44898124-44898146 GAATACTACTTGTCTAAAAGTGG - Intergenic
1067714608 10:48680666-48680688 GTATAATATATGTGTAAATGGGG - Intergenic
1067838370 10:49655632-49655654 ATAAAATCCATGTCAAAAACAGG - Intronic
1069626817 10:69873228-69873250 GTATAATCCATGTCTAAAAGGGG - Intronic
1072527414 10:96285628-96285650 GCATAAACCACGCCTAAAAGTGG + Intergenic
1073194725 10:101680520-101680542 ATATCATCCATGTCCAACAGAGG + Intronic
1076532134 10:131151953-131151975 GCATCAGCCATGGCTAAAAGGGG - Intronic
1076743381 10:132499433-132499455 GTCTAATCCAAGTCTAGAGGGGG + Intergenic
1077452731 11:2659864-2659886 TTATAATCCATTTTTAAAATTGG + Intronic
1078042153 11:7877186-7877208 GTTTCATCCATTACTAAAAGTGG - Intergenic
1079491589 11:20994934-20994956 CTAAAATCCATGTCTAACATGGG - Intronic
1080103562 11:28487194-28487216 TTAGAATACATTTCTAAAAGTGG - Intergenic
1083183957 11:61007000-61007022 GTACAATCCTGGGCTAAAAGGGG + Intronic
1087296423 11:96380676-96380698 GTTTCCTCCATGTCTAAATGTGG - Intronic
1088435801 11:109811966-109811988 ATGTAATGAATGTCTAAAAGAGG + Intergenic
1088824596 11:113483138-113483160 GTGTAATCAATGTCACAAAGAGG - Intergenic
1094305660 12:29016535-29016557 GTACAACCAATGTCTAAAATTGG - Intergenic
1099668778 12:85663662-85663684 GAATAATTCATGTTAAAAAGAGG + Intergenic
1099746234 12:86708202-86708224 GTTCAAGCCATGACTAAAAGAGG + Intronic
1101053359 12:100886940-100886962 GCAGAATCTATGTCTACAAGAGG - Intronic
1103149788 12:118627111-118627133 ATCTAATCCATGTCTAAACAAGG - Intergenic
1107455924 13:40554481-40554503 GGATACACCATGTTTAAAAGTGG - Intergenic
1108611878 13:52091986-52092008 GTATATTTCATTTCTCAAAGAGG - Intronic
1109501568 13:63243056-63243078 ATATAACCCATGTCAAAATGAGG + Intergenic
1109513036 13:63404390-63404412 GTTCTAGCCATGTCTAAAAGGGG - Intergenic
1111081949 13:83322308-83322330 GTCTCAGCCATGGCTAAAAGGGG - Intergenic
1111339257 13:86862472-86862494 GCTGAAGCCATGTCTAAAAGGGG + Intergenic
1111476789 13:88760309-88760331 GTATAATCCATGTGTGAGATTGG - Intergenic
1111640303 13:90961028-90961050 GTAGAATCCATATATAAAAAAGG - Intergenic
1112617658 13:101021668-101021690 GTATTATCTATGTCTACTAGTGG - Intergenic
1112980391 13:105377447-105377469 TTTTAACCCATGTCTAGAAGGGG - Intergenic
1113302738 13:109039591-109039613 AAATAATCCATGGATAAAAGGGG + Intronic
1115324114 14:32117655-32117677 GAAAAATCCATGTGTAAAATGGG - Intronic
1115856627 14:37636514-37636536 GAATAATCCATGGGTCAAAGAGG + Intronic
1117452836 14:55867761-55867783 AAATAATCCATGTTTCAAAGAGG - Intergenic
1120097027 14:80400885-80400907 GTATCACCCATGTATAAATGAGG + Intergenic
1122190359 14:100037689-100037711 GTAAATACCATGTCCAAAAGAGG - Intronic
1123051377 14:105545771-105545793 GTATAATCTATTTTTAAATGGGG - Intergenic
1123076790 14:105671473-105671495 GTATAATCTATTTTTAAATGGGG - Intergenic
1125839087 15:42781627-42781649 GTATAATCCATGGGTCAGAGAGG - Intronic
1134839068 16:17386967-17386989 GTAAGATCCTTGTCTCAAAGAGG + Intronic
1135919055 16:26631915-26631937 GTTCTAGCCATGTCTAAAAGGGG - Intergenic
1144444320 17:15313029-15313051 TTATAATACATTTCTAGAAGTGG - Intronic
1149966944 17:61173978-61174000 CTATAATCCATTTTTAAAAATGG + Intronic
1155413548 18:25571760-25571782 GTGCCATCCATGGCTAAAAGGGG - Intergenic
1155582148 18:27321645-27321667 GTATAAACCATGTGGAGAAGAGG - Intergenic
1157647991 18:49296866-49296888 GTATAATCCAAGTCAGACAGTGG - Intronic
1158333176 18:56385190-56385212 GAATAATCCTTGTCTAAATCAGG - Intergenic
1159107903 18:64025083-64025105 GTATGATCCATAACTAAAATTGG + Intergenic
1168023809 19:53629011-53629033 GTATAATTCAGCTGTAAAAGGGG + Intergenic
926421425 2:12703592-12703614 GTATAATGCATGTCCCAAAGTGG + Intergenic
926975228 2:18509171-18509193 GTATAATCATTTTTTAAAAGGGG + Intergenic
928798163 2:35051343-35051365 GTGTAATCCATGACCAAATGGGG - Intergenic
929345275 2:40875040-40875062 GTTTAATGGATGACTAAAAGAGG + Intergenic
930431454 2:51281720-51281742 GTAGGATCTATGTCTAAAAAAGG - Intergenic
931570263 2:63661477-63661499 GTACAATGCATGGCAAAAAGTGG + Intronic
933360714 2:81280288-81280310 TTAAAATGCATGTCTTAAAGTGG - Intergenic
934977491 2:98814393-98814415 ATATAATCCATGGATCAAAGAGG - Intronic
937598047 2:123693932-123693954 GTATAATGTATGTATAAAAGTGG + Intergenic
938151248 2:128885714-128885736 GAATAATCCAACTTTAAAAGTGG - Intergenic
941089111 2:161154097-161154119 GCATAATGCATGTCATAAAGAGG + Intronic
945708220 2:213262448-213262470 GTATAAACCAGGTCTTCAAGAGG - Intergenic
947784601 2:232804844-232804866 AAATAATCCATGGGTAAAAGAGG - Intronic
947883307 2:233541160-233541182 GTATAAACAAGTTCTAAAAGGGG + Intronic
948317930 2:237043901-237043923 GTATAGACCATATCAAAAAGTGG - Intergenic
1173013419 20:39203014-39203036 GTATTATTAATGTCCAAAAGTGG + Intergenic
1173592490 20:44235724-44235746 GAATAATGCATGTCTACAATAGG + Intergenic
1173890949 20:46509739-46509761 GTTTCATCCAAGTCTAAAACAGG + Intronic
1177481498 21:21695921-21695943 GTTTAAACCATGTCCAAATGAGG + Intergenic
1177502785 21:21980411-21980433 CTATAATCAATGTGTAAAATAGG + Intergenic
1177990529 21:28030526-28030548 GTTTCAGCCATGGCTAAAAGGGG - Intergenic
1184553591 22:45219412-45219434 GTTTAATCCTTTTCTAAAAAAGG - Intronic
949369868 3:3323087-3323109 GTAAAATCCTTGTCTCAAACTGG + Intergenic
951205504 3:19922221-19922243 GAATAATCCATATGCAAAAGTGG - Intronic
953331389 3:42055895-42055917 GTATAACAAATGTCCAAAAGAGG - Intronic
954102614 3:48388025-48388047 GAATAGTCCATGGCTCAAAGAGG - Intronic
954425609 3:50441427-50441449 GTAAAATCCATGTCATAAAAAGG + Intronic
956202156 3:66717838-66717860 GTATCATCCATGTCTACTTGAGG + Intergenic
957784074 3:84858039-84858061 TTATAATAAATGTTTAAAAGAGG + Intergenic
959753580 3:109868648-109868670 GTCTATTCCATGCCTAAAATGGG + Intergenic
959922289 3:111881978-111882000 GTATAATCCATGTGTATGGGTGG + Intronic
960317796 3:116199381-116199403 GTATAATACTAGTGTAAAAGAGG - Intronic
962074726 3:132069789-132069811 TTATAATCCTTTTATAAAAGAGG - Intronic
963581494 3:147131346-147131368 GTATAGTCAATATCTAAAATAGG - Intergenic
963645858 3:147913373-147913395 TTATAATACATGTCTAGAAGTGG + Intergenic
964594667 3:158411299-158411321 GTATACTCTATACCTAAAAGTGG + Intronic
965904875 3:173691551-173691573 GTTTAATACGTGTCTTAAAGTGG + Intronic
969272270 4:6110969-6110991 CCAGCATCCATGTCTAAAAGAGG + Intronic
970784899 4:19783910-19783932 GTCTCAGCCATGGCTAAAAGGGG - Intergenic
971063032 4:22993913-22993935 CTGTAATCCTTGTCTAAAAGGGG + Intergenic
971962516 4:33507504-33507526 GTCTCAGCCATGGCTAAAAGTGG + Intergenic
972143909 4:35997452-35997474 GTATAATACATTTCTAGAGGTGG - Intronic
972171178 4:36347225-36347247 GTATAATCAATTTCTGAAATTGG + Intergenic
974469237 4:62296996-62297018 GCTTCAGCCATGTCTAAAAGGGG - Intergenic
974739563 4:65987813-65987835 GTATAAACCATGGATCAAAGTGG + Intergenic
975471848 4:74778765-74778787 GTTTTATCCAAGTCTCAAAGTGG + Intronic
976791002 4:88878440-88878462 CATTAATCCATGTCTAGAAGAGG - Intronic
977514379 4:98002039-98002061 GTGAAATCAAAGTCTAAAAGAGG + Intronic
979249661 4:118552990-118553012 GTATAACCCATGAGTAAAAGTGG + Intergenic
980254784 4:130364932-130364954 GAATAAAATATGTCTAAAAGAGG - Intergenic
980646096 4:135644108-135644130 GTTTTAGCCATGGCTAAAAGGGG + Intergenic
981442355 4:144797508-144797530 GGATAATTCATAACTAAAAGAGG - Intergenic
981567983 4:146121089-146121111 GTAAGATACATGTCTATAAGAGG + Intergenic
981576318 4:146209596-146209618 CTATAATTTATGTCCAAAAGAGG - Intergenic
983915524 4:173287488-173287510 GTGTTATCCATGTAGAAAAGAGG + Intronic
984672032 4:182501353-182501375 GTTAAAGCTATGTCTAAAAGTGG + Intronic
986245143 5:6000381-6000403 GGATAATCCATGTTTGAAATAGG - Intergenic
987662431 5:20894440-20894462 GTTTCAGCCATGACTAAAAGAGG + Intergenic
988761150 5:34310877-34310899 GTTTCAGCCATGACTAAAAGGGG - Intergenic
991248229 5:64530618-64530640 GTACAAATCATGTCTAAATGTGG + Intronic
991296487 5:65086615-65086637 GTATAATCCATGACTATTTGGGG - Intergenic
993500018 5:88655369-88655391 GTATAAACCATCTATAAAATAGG - Intergenic
993938215 5:94028402-94028424 GTTTATTCCATTTTTAAAAGAGG - Intronic
994025933 5:95083635-95083657 GTCTAAAACTTGTCTAAAAGAGG + Intronic
996573230 5:124955481-124955503 GTAAAAACCATGTCTAAAGCAGG + Intergenic
998022929 5:138786615-138786637 GAATAATCCATGAGAAAAAGTGG - Intronic
1000714211 5:164621216-164621238 ATATAATCAGTGTCTAAAAACGG + Intergenic
1001603041 5:172941411-172941433 GTTTAATCCATTTATAAAACAGG - Intronic
1003871513 6:10407065-10407087 AAATAATCCATGTTTAAAAGGGG + Intronic
1004640094 6:17506681-17506703 CCATAATCCATGTGAAAAAGTGG - Intronic
1005030271 6:21501967-21501989 GTATAGTCCAAGGCTAAAAGCGG + Intergenic
1005470720 6:26159692-26159714 GGATGATCATTGTCTAAAAGAGG + Intronic
1007146453 6:39638709-39638731 GTATAATACATGTCTTAACTAGG - Intronic
1013975212 6:116069617-116069639 GTCTTATCCAGGTATAAAAGTGG + Intergenic
1015860965 6:137679382-137679404 GTATAACCCATGGATAAAATTGG + Intergenic
1016834585 6:148464604-148464626 ATATAACCCAAGTCCAAAAGTGG - Intronic
1017767891 6:157621968-157621990 CTATAATCCATATCTGACAGCGG - Intronic
1017938110 6:159025064-159025086 GTTTCAGCCATGGCTAAAAGGGG - Intergenic
1018689312 6:166332077-166332099 GAATATTCCATGTTTACAAGTGG - Intronic
1023472735 7:40542280-40542302 GAGTAAACCATGTCTCAAAGAGG + Intronic
1025717192 7:63970927-63970949 GTATTATTCATTACTAAAAGCGG - Intergenic
1028032406 7:85932815-85932837 GTTTCAGCCATGGCTAAAAGAGG + Intergenic
1028668948 7:93378868-93378890 GTATCATCCATGTCCATTAGTGG - Intergenic
1029102584 7:98145015-98145037 GTAGAATACATTTCTTAAAGTGG + Intronic
1031725618 7:125234352-125234374 ATTTCATCCATGTCTAAAAATGG + Intergenic
1041737865 8:61130983-61131005 GTGACATCCATGTCTAAAATGGG - Intronic
1042647706 8:71005607-71005629 TTCTTATCCATGTCTAGAAGTGG + Intergenic
1043308196 8:78823400-78823422 GCATCAGCCATGGCTAAAAGGGG + Intergenic
1045959251 8:107947974-107947996 GTAGAAACCATGTTTAAAAAGGG - Intronic
1046107418 8:109682870-109682892 TTCTAAGCCATGGCTAAAAGGGG + Intronic
1046691161 8:117286167-117286189 GTCTAATCCATGTACAGAAGAGG - Intergenic
1048518675 8:135134231-135134253 GTAAAAACAATGTCTGAAAGTGG - Intergenic
1049465013 8:142747113-142747135 GAATAATGTATGGCTAAAAGGGG + Intergenic
1051128698 9:13835104-13835126 GTCTTAGCCATGGCTAAAAGGGG + Intergenic
1055850104 9:80616731-80616753 GTAAAATCCATGTATAGAACTGG + Intergenic
1056050687 9:82765622-82765644 ATATAGTCCATCACTAAAAGGGG - Intergenic
1058485261 9:105437206-105437228 GTAAAATACATGTTTAACAGAGG - Intronic
1060308874 9:122441209-122441231 TTATAACCAATGTCTAAAACTGG + Intergenic
1186222297 X:7363018-7363040 GTATAATACATGGATAAATGTGG + Intergenic
1186792178 X:13009960-13009982 GTATACTCCACGTCTGGAAGTGG - Intergenic
1186798822 X:13072538-13072560 AAATTAGCCATGTCTAAAAGAGG + Intergenic
1187260372 X:17679931-17679953 GTATACTCTAAGTCTCAAAGTGG + Intronic
1187282810 X:17873589-17873611 AAATAATCCATGTGTCAAAGAGG - Intergenic
1189112479 X:38306285-38306307 TTATAATCCCTATCTAACAGAGG + Intronic
1189428459 X:40924891-40924913 AAATAATCCATGTGTCAAAGGGG - Intergenic
1190117483 X:47635983-47636005 GTATAATCTATTTTTAAATGGGG - Exonic
1190847975 X:54211867-54211889 CAATAATCCATGGATAAAAGAGG + Intronic
1191882718 X:65858522-65858544 GTATTAACCATGTGTAAATGGGG - Intergenic
1193250221 X:79281896-79281918 GTCTCAGCCATGGCTAAAAGGGG - Intergenic
1195476165 X:105288221-105288243 GTATATTCCATGGCTGAGAGTGG + Intronic
1196400656 X:115312675-115312697 GTATACTCCCTGTATAAATGGGG + Intergenic
1196641104 X:118062108-118062130 ATCTAAACCATGTCTTAAAGTGG + Intronic