ID: 1069627186

View in Genome Browser
Species Human (GRCh38)
Location 10:69875555-69875577
Sequence TGGGAACCCTGGCTCCACCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069627186_1069627194 15 Left 1069627186 10:69875555-69875577 CCTCGGTGGAGCCAGGGTTCCCA No data
Right 1069627194 10:69875593-69875615 GACAGAGATGCACTAAGAGATGG No data
1069627186_1069627196 26 Left 1069627186 10:69875555-69875577 CCTCGGTGGAGCCAGGGTTCCCA No data
Right 1069627196 10:69875604-69875626 ACTAAGAGATGGTGAAGACAGGG No data
1069627186_1069627195 25 Left 1069627186 10:69875555-69875577 CCTCGGTGGAGCCAGGGTTCCCA No data
Right 1069627195 10:69875603-69875625 CACTAAGAGATGGTGAAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069627186 Original CRISPR TGGGAACCCTGGCTCCACCG AGG (reversed) Intronic