ID: 1069628929

View in Genome Browser
Species Human (GRCh38)
Location 10:69885860-69885882
Sequence TCTCCTCCCTCGTGCCCTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069628928_1069628929 -6 Left 1069628928 10:69885843-69885865 CCGATAGATGAGTGGGATCTCCT 0: 1
1: 0
2: 0
3: 5
4: 55
Right 1069628929 10:69885860-69885882 TCTCCTCCCTCGTGCCCTTTTGG No data
1069628926_1069628929 -1 Left 1069628926 10:69885838-69885860 CCCTTCCGATAGATGAGTGGGAT 0: 1
1: 0
2: 0
3: 4
4: 52
Right 1069628929 10:69885860-69885882 TCTCCTCCCTCGTGCCCTTTTGG No data
1069628927_1069628929 -2 Left 1069628927 10:69885839-69885861 CCTTCCGATAGATGAGTGGGATC No data
Right 1069628929 10:69885860-69885882 TCTCCTCCCTCGTGCCCTTTTGG No data
1069628923_1069628929 6 Left 1069628923 10:69885831-69885853 CCAGGGGCCCTTCCGATAGATGA 0: 1
1: 0
2: 0
3: 0
4: 47
Right 1069628929 10:69885860-69885882 TCTCCTCCCTCGTGCCCTTTTGG No data
1069628920_1069628929 23 Left 1069628920 10:69885814-69885836 CCTTGAGAGGAGAAAAGCCAGGG 0: 1
1: 0
2: 3
3: 68
4: 385
Right 1069628929 10:69885860-69885882 TCTCCTCCCTCGTGCCCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069628929 Original CRISPR TCTCCTCCCTCGTGCCCTTT TGG Intronic
No off target data available for this crispr