ID: 1069629035

View in Genome Browser
Species Human (GRCh38)
Location 10:69886598-69886620
Sequence GCTCCTTTCTACCATGTTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 131}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069629035_1069629038 -2 Left 1069629035 10:69886598-69886620 CCTTGAACATGGTAGAAAGGAGC 0: 1
1: 0
2: 0
3: 18
4: 131
Right 1069629038 10:69886619-69886641 GCCTTTGCTGGTTCTTGAGAGGG No data
1069629035_1069629037 -3 Left 1069629035 10:69886598-69886620 CCTTGAACATGGTAGAAAGGAGC 0: 1
1: 0
2: 0
3: 18
4: 131
Right 1069629037 10:69886618-69886640 AGCCTTTGCTGGTTCTTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069629035 Original CRISPR GCTCCTTTCTACCATGTTCA AGG (reversed) Intronic
902161608 1:14535032-14535054 GCCCCTTTCTCCCTTCTTCAAGG + Intergenic
902735738 1:18399471-18399493 GATCCTGTCTTCCATGTTAATGG - Intergenic
903448319 1:23436628-23436650 GCTCGTGTTTCCCATGTTCAAGG + Exonic
907619602 1:55963081-55963103 CCTCATTTCTATCATTTTCATGG + Intergenic
912175487 1:107150716-107150738 GCTCCTGTCTGTCATGTTGAAGG + Intronic
918816070 1:189185738-189185760 GGTGCTTTCTGCCATGTTGAAGG + Intergenic
920521235 1:206628446-206628468 GCTCCTTTTCACCATCTTCAGGG - Intergenic
921001702 1:211050768-211050790 TCACCTTTCTACCTTGATCATGG - Intronic
1063682689 10:8204925-8204947 GCTCTTCTCTACCATGTTGATGG - Intergenic
1065286490 10:24192301-24192323 GCTCCTTTCTTCCAGGTATAGGG + Intronic
1069629035 10:69886598-69886620 GCTCCTTTCTACCATGTTCAAGG - Intronic
1070070111 10:73079937-73079959 GCTGCTTTCTACCATTCACAAGG - Intronic
1070857907 10:79622384-79622406 GATTCTTTCTACCATGAGCATGG - Intergenic
1071188623 10:83075000-83075022 GCTTGTTTCCACCATCTTCATGG - Intergenic
1071934868 10:90517790-90517812 GCTCATTATTACTATGTTCAGGG + Intergenic
1072943962 10:99792968-99792990 GCTCCTTTAGACCATGTGCTCGG + Intronic
1076079503 10:127565943-127565965 ACTCCTTTCTTCCATGGTCTTGG + Intergenic
1078475079 11:11622583-11622605 GCTCCTTTCAGCCAGGTTTAGGG - Intergenic
1082992841 11:59223208-59223230 GGTCCTGTGTACAATGTTCAAGG - Intergenic
1089182577 11:116593268-116593290 CCTCCTTTCTACCATCCTCACGG - Intergenic
1090720525 11:129468072-129468094 GCTCCTTTTTCTCATGTTCATGG - Intergenic
1092954707 12:13539069-13539091 GCTACTTTCTGGAATGTTCAGGG + Exonic
1092986933 12:13854851-13854873 GCTGATTCCTACCATTTTCAAGG + Intronic
1094680490 12:32662894-32662916 GCTTCTATCTACCATGTTTTGGG + Intergenic
1095615630 12:44184540-44184562 GTCCCCTTCTACCATCTTCAAGG - Intronic
1096738558 12:53675522-53675544 TCCCACTTCTACCATGTTCAAGG + Intronic
1099289608 12:80760676-80760698 GCTCCTTTCCTCCAGGTACAGGG + Intergenic
1099784083 12:87237719-87237741 GGTCCTTTCTACAATGTTTTTGG - Intergenic
1100225878 12:92555284-92555306 ACTCCTTCCTGCCATGTACAAGG + Intergenic
1102722602 12:115030532-115030554 ACTCCATTCTACCTTCTTCAAGG + Intergenic
1103181674 12:118917710-118917732 TCTCCTTTCTAGCATTATCAGGG + Intergenic
1103238417 12:119394180-119394202 TCTCATTTCTACCATGGTGAAGG - Intronic
1104274376 12:127311649-127311671 GCTCAATTCTCCCATGTTCCCGG + Intergenic
1106061530 13:26297624-26297646 GTTCCTTTCTCTCAAGTTCAAGG + Intronic
1107813816 13:44226016-44226038 GTTCCATTCTACCATCTTTATGG + Intergenic
1110231270 13:73170038-73170060 GTTCCTGTCTGCCCTGTTCAAGG - Intergenic
1110268479 13:73566799-73566821 GCTCCCTTCCTCCATGTTCAAGG - Intergenic
1110822550 13:79933638-79933660 TCCCCTTTCTACCACCTTCAGGG + Intergenic
1111704443 13:91731045-91731067 GCTCCTGTCTACCATGGACTGGG + Intronic
1112287560 13:98117606-98117628 ACTGCTTTCTACCATGTAAAGGG - Intergenic
1113561297 13:111283575-111283597 CCTCCTTTCTGCCATGCACAGGG + Intronic
1116637355 14:47414217-47414239 GCTCTTATCTGCAATGTTCATGG - Intronic
1119999626 14:79288271-79288293 GCTCCTTTCTAGCATTATTAAGG - Intronic
1121467563 14:94125893-94125915 GCTCCTTCCTGCCATGTTCCTGG - Intergenic
1121848974 14:97202004-97202026 GCTCATTGCTTCCATCTTCAAGG + Intergenic
1127125211 15:55804835-55804857 TTTCCTTTCTTCCATGTTCATGG - Intergenic
1129094694 15:73192966-73192988 GGTGATTTCTACCTTGTTCAAGG + Intronic
1130098757 15:80876091-80876113 GCTCCTTCCCAGCATATTCATGG + Intronic
1130579412 15:85122405-85122427 ACTCCTTTCTGCCATGTTCTAGG + Intronic
1130676731 15:85959399-85959421 ACTCCTTTGCACCATGTTCTTGG + Intergenic
1138327604 16:56189248-56189270 GCACCTACCTACCATGTACAGGG - Intergenic
1138549708 16:57740710-57740732 GCTCCTGTCTGCCATCTCCACGG + Intronic
1141368259 16:83464038-83464060 GCTCCTTTATGCTATGTTCTAGG + Intronic
1142994617 17:3753330-3753352 GCTCCATTTTACCACGTTCATGG - Exonic
1144327082 17:14192790-14192812 GCTCATTTTTACCATGTGTAAGG + Intronic
1144723743 17:17490610-17490632 GCTCTCTTCTACCATGGTCATGG - Intronic
1146248086 17:31308934-31308956 TCTCCTTTCTGCCTTCTTCAAGG - Intronic
1149333709 17:55612336-55612358 GATCATTTCTACCTTGCTCAGGG - Intergenic
1149448104 17:56729426-56729448 GTTCCTTTCTAACATGTCCCTGG - Intergenic
1149485178 17:57036972-57036994 GCTCCTTTCTGCCATTTTCCAGG - Intergenic
1150117934 17:62571008-62571030 GCTCATTTCTACCCTTTTCAGGG - Intronic
1150700654 17:67444251-67444273 TCTTCTTTCCACCAGGTTCATGG - Intronic
1151185363 17:72360257-72360279 GATCCTTCCTACCCTTTTCATGG - Intergenic
1151669731 17:75565412-75565434 GCCTCTATCTACCCTGTTCAGGG + Intronic
1152503869 17:80733901-80733923 GCTCATTTCTTCCATTTTCAAGG + Intronic
1155385334 18:25271294-25271316 GCTTCTTCCTACCATGAGCATGG - Intronic
1156346844 18:36264658-36264680 GCTCCTTTCCAGCAAGTTCTGGG + Intronic
1156927096 18:42595705-42595727 CCACCTCTCTAGCATGTTCAGGG + Intergenic
1157281468 18:46348964-46348986 GCTCCATGCAACCAAGTTCAAGG - Intronic
1159117161 18:64127887-64127909 CCTCATTCCTAGCATGTTCAGGG - Intergenic
1162581755 19:11535715-11535737 GCTCCTTTCTGGCATTTTCCAGG - Intergenic
1167422595 19:49412994-49413016 GCTCCTTCCTTCCTTCTTCAGGG - Exonic
1167527569 19:49994595-49994617 GCTCCTTCCTCCAATGCTCATGG + Intronic
925026334 2:610157-610179 GCTACTCTTTACCATGTGCATGG - Intergenic
925373314 2:3362923-3362945 TCTCCTTCCTACCATGTGTATGG - Intronic
931883044 2:66587160-66587182 GCTCCCTTCTTCCATTTTCTTGG - Intergenic
933981806 2:87556498-87556520 TCTCATTTCAACAATGTTCAGGG + Intergenic
935222429 2:101027170-101027192 GCTCCCTCCTCCCATGTTCTAGG + Intronic
936312032 2:111394319-111394341 TCTCATTTCAACAATGTTCAGGG - Intergenic
937818628 2:126282501-126282523 TGTCATTTCAACCATGTTCATGG - Intergenic
938272676 2:129988903-129988925 GGTCCTTACTACAAGGTTCATGG - Intergenic
941495776 2:166200386-166200408 TCTCCTTTTTACTAAGTTCATGG + Intronic
942277038 2:174330847-174330869 GCTTCCTTCTCCCTTGTTCATGG + Intergenic
943733913 2:191332795-191332817 ACTACTCTGTACCATGTTCAAGG - Intronic
944513140 2:200484146-200484168 GCCCTTTTCTTCCAGGTTCAGGG - Intergenic
945167800 2:206964721-206964743 GCTCCTTTTTCCCAGTTTCAGGG + Intronic
945496385 2:210511707-210511729 GCTCCTTTCTATGTTGTTCTAGG - Intronic
946076131 2:217075188-217075210 GCTTTTCTCTACCCTGTTCAGGG + Intergenic
946116162 2:217464353-217464375 CCTCCTTTCTACCATCTTCCTGG + Intronic
949069747 2:242017306-242017328 GCTGCTTTCTACCAGGCTCTGGG - Intergenic
1171534952 20:25879067-25879089 TGTCCTTTCCACAATGTTCACGG - Intergenic
1172812834 20:37662038-37662060 GCTCCCTTCCTCCATCTTCAAGG + Intergenic
1173690077 20:44953835-44953857 GCTCTTTGCTGCCATGTTGAGGG - Intronic
1175089990 20:56494559-56494581 TCACCTTTCTACCATGTGAATGG + Intronic
1183153394 22:36055294-36055316 GTTTCTCTCTTCCATGTTCAAGG + Intergenic
949915517 3:8960397-8960419 TCTCCTTCTTACCATGTTCCTGG - Intronic
953620937 3:44532189-44532211 GCTCCTTTCTCACACCTTCAGGG + Intergenic
954760428 3:52869986-52870008 GCTTCTTGCTAGCATGTGCATGG - Intronic
956304489 3:67809015-67809037 TCACCATTCTACCATGTACAAGG + Intergenic
956782597 3:72615934-72615956 GCTCCTTCCTTTCATGTCCACGG - Intergenic
958528847 3:95297665-95297687 GATCCTTCCTACAATGTTAAAGG - Intergenic
960165011 3:114391370-114391392 ACTCTTTCCTACCATGTTCATGG + Intronic
960208821 3:114935184-114935206 CCTCCTCCCTACCATGTTCTTGG + Intronic
965853601 3:173061653-173061675 GCTTCTTTCCACCCTGTTAAGGG - Intronic
966857126 3:184202473-184202495 GCTTCTTTCTATCTTGTTCCAGG + Intronic
969222634 4:5771303-5771325 GGCCCTTTCTTCCATCTTCAGGG + Intronic
971060754 4:22966564-22966586 GTTACTATCTACCATGTCCATGG - Intergenic
974196673 4:58584719-58584741 GCTGGTTTCTCCCATCTTCATGG + Intergenic
977581978 4:98735688-98735710 TGTCCTTTCTACCTTCTTCAAGG - Intergenic
983792407 4:171813805-171813827 CCTCCTTTCCACCAGGTTCCCGG + Exonic
990825201 5:59892109-59892131 GCTCCTTTCTTCCCTGTCCCAGG - Intronic
993091806 5:83435377-83435399 GCTGCTTTCTGCCTTGTTCCAGG - Intergenic
995332315 5:110958938-110958960 GGTCCTTTCTACACAGTTCAAGG - Intergenic
995524731 5:113041346-113041368 ACTCCTTTCTAAGATGCTCAGGG - Intronic
996464101 5:123779740-123779762 ACTCCTTTCTCCCAAGTTCTGGG - Intergenic
999961063 5:156756081-156756103 GTTCCTTTTTAACATGTTTAAGG + Intronic
1001034513 5:168288093-168288115 TCTCCTCTTTACCATCTTCATGG + Intergenic
1002113589 5:176938780-176938802 TCTCCTTTCTCCCATTGTCAGGG + Intronic
1004442767 6:15669721-15669743 GCTCCTTTCTTCCATGTATAAGG - Intergenic
1007254916 6:40521921-40521943 GCTCCATTCTTCCATGATCTTGG + Intronic
1007806366 6:44452420-44452442 GCTCCTTTATACTGTGGTCAGGG + Intergenic
1008473347 6:51909229-51909251 GTTTCTTTCTCCCATGTTTAAGG - Intronic
1011706830 6:90008967-90008989 CCTCCTTCCTGCCATGCTCATGG - Intronic
1011841143 6:91500356-91500378 ACACATTTCTCCCATGTTCAAGG - Intergenic
1014797529 6:125743818-125743840 GTCCCTTTCTTCCATATTCAAGG + Intergenic
1017362855 6:153596196-153596218 GTACATTTCTATCATGTTCAAGG + Intergenic
1017815235 6:158011421-158011443 GTTCCTGTCCACCATGGTCAAGG + Intronic
1018394660 6:163368952-163368974 ACTCCTTCCTTCCATCTTCAGGG - Intergenic
1019699965 7:2470059-2470081 GCTCCTTCCAACCATGCACAGGG - Intergenic
1020718767 7:11714813-11714835 GCTCTTTTCTACCAAATTTAAGG + Intronic
1022046098 7:26623736-26623758 GCTCCTGTCTAGAATGTTCTAGG - Intergenic
1034799454 7:154044711-154044733 ACTCCTTTCAAGCATGTTAAAGG - Intronic
1037039438 8:14212133-14212155 GCTCCTTACTACAATGTGAATGG - Intronic
1039705542 8:40003095-40003117 ACTCTCTTATACCATGTTCATGG - Intronic
1040023907 8:42764224-42764246 ATTCCTTGCTACCATGTTCAAGG - Intronic
1041971022 8:63742771-63742793 ACTCCTTTCTACCATTCTTATGG - Intergenic
1042952793 8:74218875-74218897 GTTCCTTTTTACCTTGTTTATGG - Intergenic
1044823211 8:96172604-96172626 GCTCATTGCTACCATTTTCCAGG + Intergenic
1048450615 8:134530141-134530163 TCTCCTTTAAACCATGTGCAGGG - Intronic
1050277408 9:4014219-4014241 GTTCTTTTCTCCCATATTCAAGG - Intronic
1052458540 9:28732483-28732505 TCTATTTTCTACCATATTCAAGG - Intergenic
1057518885 9:95745060-95745082 GTTGCTGTCTACCAAGTTCATGG - Intergenic
1059886817 9:118753987-118754009 TCCCCTTTCTACCATGTGCAAGG - Intergenic
1061466695 9:130786102-130786124 GCTCCTTTCTGCCCTGTGGATGG - Intronic
1186363976 X:8872599-8872621 GCTCCCTTGTTCCATTTTCAAGG - Intergenic
1186750873 X:12620018-12620040 GCTCCTCTCAGCCATGGTCAGGG + Intronic
1195763806 X:108275295-108275317 GATACTTTCAACTATGTTCAAGG + Intronic
1199577469 X:149327082-149327104 CTTCCTTTCTACCATGTTGTAGG + Intergenic
1202000840 Y:20154470-20154492 TCTTCCTTCTAGCATGTTCATGG + Intergenic
1202003591 Y:20191255-20191277 TCTTCCTTCTAGCATGTTCATGG + Intergenic