ID: 1069629071

View in Genome Browser
Species Human (GRCh38)
Location 10:69886892-69886914
Sequence GAGCATCCCCTAATCTTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 88}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069629071_1069629079 30 Left 1069629071 10:69886892-69886914 CCCACAAAGATTAGGGGATGCTC 0: 1
1: 0
2: 0
3: 8
4: 88
Right 1069629079 10:69886945-69886967 CTGGCTAGAGTGAGAGGAACAGG No data
1069629071_1069629076 11 Left 1069629071 10:69886892-69886914 CCCACAAAGATTAGGGGATGCTC 0: 1
1: 0
2: 0
3: 8
4: 88
Right 1069629076 10:69886926-69886948 AACTGCTAGGAGAAGCCTGCTGG No data
1069629071_1069629073 -2 Left 1069629071 10:69886892-69886914 CCCACAAAGATTAGGGGATGCTC 0: 1
1: 0
2: 0
3: 8
4: 88
Right 1069629073 10:69886913-69886935 TCAGAGATTGCCCAACTGCTAGG No data
1069629071_1069629077 24 Left 1069629071 10:69886892-69886914 CCCACAAAGATTAGGGGATGCTC 0: 1
1: 0
2: 0
3: 8
4: 88
Right 1069629077 10:69886939-69886961 AGCCTGCTGGCTAGAGTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069629071 Original CRISPR GAGCATCCCCTAATCTTTGT GGG (reversed) Intronic
900474477 1:2869721-2869743 GAGCCTCCCCTCATCGGTGTCGG + Intergenic
905943257 1:41880826-41880848 GAGCATCCCCTAATCCTGATAGG + Intronic
909002111 1:70230850-70230872 AATTATCCCATAATCTTTGTAGG + Intronic
909519635 1:76552217-76552239 GAGAGTCCCTTGATCTTTGTGGG - Intronic
910366688 1:86472954-86472976 GAGAATCCACAAATCTTTGAGGG - Intronic
910480296 1:87651360-87651382 GAGCAGCCTCTAATCTTTAATGG - Intergenic
912069466 1:105790954-105790976 GAGCATTATCCAATCTTTGTAGG - Intergenic
912686179 1:111767610-111767632 GAGCAGCTCTTAATCTTTTTTGG + Exonic
919594858 1:199548505-199548527 CACCATCCCCAAATCTATGTTGG + Intergenic
921291098 1:213658373-213658395 GGGCTTCCCTTAATCTTTGGAGG - Intergenic
1065285249 10:24181392-24181414 GAGCATGCCCTCTTCTTTGGAGG + Intronic
1069629071 10:69886892-69886914 GAGCATCCCCTAATCTTTGTGGG - Intronic
1072190937 10:93075507-93075529 GAGCATCCCCTAGCCTTTCCAGG + Intronic
1075899887 10:126032765-126032787 GAGCATGCCCTAAACTTTTCTGG - Intronic
1076141311 10:128080547-128080569 GAGCTTCCCCTAGTCTTTTTAGG + Intronic
1077714364 11:4566913-4566935 AAGCATCCCCAAAACTTTCTAGG + Intergenic
1079655924 11:22986785-22986807 GACCCACCCCTAATCTTGGTGGG - Intergenic
1080420973 11:32110188-32110210 GGCCATCCCCTAATACTTGTGGG - Intergenic
1081481428 11:43493218-43493240 GATCATTTCCCAATCTTTGTTGG + Intronic
1082936312 11:58660531-58660553 GAGACTCCCCTACTCCTTGTCGG - Intronic
1085842661 11:80030435-80030457 GAGCATCCCTGAGTCTTTATGGG + Intergenic
1087717818 11:101629375-101629397 GACCCACCCTTAATCTTTGTGGG - Intronic
1088535959 11:110861678-110861700 GGGCCTGTCCTAATCTTTGTTGG + Intergenic
1089806566 11:121095905-121095927 TAGCATCCCTGAATCTTTGTAGG + Intergenic
1095946460 12:47756549-47756571 GAGGAGCCCCTCATCTTGGTAGG + Intronic
1096333819 12:50737883-50737905 CAGCCTCCCCAAATCTTTGAAGG + Intronic
1098000248 12:65934084-65934106 GAGAATTCCCTATTCTTTGAGGG - Intronic
1098037130 12:66315731-66315753 AAATATCCCCTAATTTTTGTGGG + Intronic
1105656832 13:22450862-22450884 CAGCATCCCTTCATTTTTGTGGG + Intergenic
1107475147 13:40728582-40728604 GAGCATCCCCTGATCCTAGGAGG - Intergenic
1110380462 13:74844480-74844502 GACAATCCCCTTACCTTTGTGGG - Intergenic
1112229878 13:97578768-97578790 TGGCATCCCCTCATGTTTGTTGG - Intergenic
1116653803 14:47626786-47626808 GAGCATCCCCCACCCTCTGTGGG + Intronic
1117556562 14:56892118-56892140 GAGTATCCCCTTATTTTTATAGG - Intergenic
1119266579 14:73266356-73266378 AAGCATCCCCTAGTGTTTGGTGG - Intronic
1119553181 14:75531859-75531881 GACCATGCCATAATGTTTGTTGG + Intronic
1122572629 14:102717476-102717498 GAGAATCACTTAATCTTTCTAGG + Intronic
1124603432 15:31152730-31152752 GAGGATCACTTAATCTTGGTAGG - Intronic
1133772971 16:8878387-8878409 GGGCATCCCCTAACCTCTCTGGG - Intergenic
1142759828 17:2035805-2035827 GTGCCCCTCCTAATCTTTGTTGG + Intronic
1146952959 17:36919361-36919383 GACCTTCCCCTTGTCTTTGTGGG + Intergenic
1154090991 18:11362989-11363011 GAGCCTCCCCAAATCTCTGCTGG - Intergenic
1156781218 18:40853094-40853116 GAGACTCCCCCAAGCTTTGTTGG + Intergenic
1158597815 18:58831866-58831888 GAGAAGCCACTAATCTTTGTTGG + Intergenic
1163205666 19:15800810-15800832 GGGCATCCTCTAATCTGTGGAGG + Intergenic
1167521196 19:49956431-49956453 AAGCACCTCCTAGTCTTTGTTGG + Intronic
926078286 2:9961068-9961090 GAGCAGCCCCTCATCTCTGCTGG + Exonic
926374156 2:12210026-12210048 GACCATCACCTAATGTTTGCTGG - Intergenic
926423361 2:12718930-12718952 GGGGATTCCCTAATCCTTGTTGG - Intronic
927012664 2:18922003-18922025 GAGCATTCCTTCATGTTTGTTGG + Intergenic
935384144 2:102483526-102483548 GAGCAACCCCTTCTCTTTGGTGG - Intronic
935959655 2:108412357-108412379 GAGCATCATCTAATCTATATTGG + Intergenic
941443233 2:165565129-165565151 CAGCAACCACTACTCTTTGTAGG - Intronic
942496474 2:176545390-176545412 CAGCATCCACTAATCTTTGGGGG + Intergenic
943164470 2:184302410-184302432 GAGTATCCCCTTACCCTTGTGGG + Intergenic
944103422 2:196054006-196054028 GAGCAAGGCCTAATCTTTGTTGG + Intronic
1169218217 20:3805411-3805433 GGGCTGCCCCTAATCTCTGTAGG + Exonic
1182234421 22:28864359-28864381 AAGCATCCTCTAGTCTTTGGAGG + Intergenic
956612073 3:71134419-71134441 ACACTTCCCCTAATCTTTGTGGG - Intronic
958791210 3:98653471-98653493 GAGCACCCCCTATTCATTATGGG + Intergenic
963492353 3:146017333-146017355 TAGCATCCCCTGATATTTCTTGG + Intergenic
964404777 3:156338069-156338091 GACCATCCCCTCATCTCTGGAGG - Intronic
970522893 4:16903357-16903379 GAGCATGGCTTAATCTTTGGGGG - Intergenic
971378652 4:26076567-26076589 GAGCTTCCCTTTATCTTTGTAGG - Intergenic
973309672 4:48694970-48694992 GAGGATCACCTAAGCTTGGTAGG + Intronic
973544079 4:51962765-51962787 GAGAATGCCCAAATCTTAGTAGG - Intergenic
976262151 4:83155848-83155870 GAGCTTCCACTCTTCTTTGTGGG - Intergenic
978327245 4:107573477-107573499 GAACCTCCCCTAATATTTGCAGG + Intergenic
978722517 4:111928269-111928291 GAGCATTTCCTCATGTTTGTTGG + Intergenic
978827291 4:113040827-113040849 GAGCAGTCCCTAATGTTTTTGGG + Intronic
988117522 5:26916399-26916421 GAGTATCCCCTTATCTGTGGGGG + Intronic
993747454 5:91618697-91618719 GACCCTCACCTAATCTTTGCTGG + Intergenic
998065779 5:139157286-139157308 GAGAAGCTCCTAACCTTTGTTGG + Intronic
1007205920 6:40150868-40150890 GAGGATCCTTTAATATTTGTTGG + Intergenic
1009491551 6:64298865-64298887 TAGCAACCCCTAATCTCTTTTGG - Intronic
1010339996 6:74738771-74738793 GAGAATCCCATAAACTTTGTGGG + Intergenic
1010435879 6:75830251-75830273 GAGTATTCCCTGATCTTTATAGG - Intronic
1011860616 6:91751291-91751313 AAGCATCTCCTATTCTTTTTGGG + Intergenic
1014863462 6:126498499-126498521 GAGCATTCTCTAAATTTTGTTGG - Intergenic
1018718140 6:166551210-166551232 GATGCTCCCCTAATCTTTGAAGG + Intronic
1024388422 7:48779938-48779960 GAGAATCCCCTTCTCTTTCTAGG - Intergenic
1029591285 7:101508730-101508752 GAGAGACCCCTAATCTTTGCTGG + Intronic
1029970437 7:104783251-104783273 GAGCAGTCCCTATTCCTTGTTGG - Intronic
1033226729 7:139568622-139568644 GAGCATCCTCTAGTCTTTTGTGG - Exonic
1038378950 8:27074145-27074167 GAGGAACCCCTAATCTAGGTGGG - Intergenic
1044274104 8:90280223-90280245 GAGAATCCCCTTACCTTTCTAGG - Intergenic
1047768723 8:128012919-128012941 GAGAATCACCAAATTTTTGTTGG + Intergenic
1053695649 9:40637068-40637090 GACCCACCCTTAATCTTTGTGGG - Intergenic
1053942639 9:43268107-43268129 GACCCACCCTTAATCTTTGTGGG - Intergenic
1054306896 9:63436286-63436308 GACCCACCCTTAATCTTTGTGGG - Intergenic
1054405627 9:64760274-64760296 GACCCACCCTTAATCTTTGTGGG - Intergenic
1054439254 9:65245761-65245783 GACCCACCCTTAATCTTTGTGGG - Intergenic
1054491152 9:65776178-65776200 GACCCACCCTTAATCTTTGTGGG + Intergenic
1202778094 9_KI270717v1_random:10680-10702 GACCCACCCTTAATCTTTGTGGG - Intergenic
1191792689 X:64987481-64987503 GATCATCCTTTCATCTTTGTGGG - Intronic
1193670515 X:84378986-84379008 TAGCAACTCCTAATCTTTTTTGG - Intronic
1198634893 X:138686191-138686213 CAGCATTCTCTAATATTTGTTGG - Intronic