ID: 1069629072

View in Genome Browser
Species Human (GRCh38)
Location 10:69886893-69886915
Sequence TGAGCATCCCCTAATCTTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 96}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069629072_1069629079 29 Left 1069629072 10:69886893-69886915 CCACAAAGATTAGGGGATGCTCA 0: 1
1: 0
2: 0
3: 15
4: 96
Right 1069629079 10:69886945-69886967 CTGGCTAGAGTGAGAGGAACAGG No data
1069629072_1069629073 -3 Left 1069629072 10:69886893-69886915 CCACAAAGATTAGGGGATGCTCA 0: 1
1: 0
2: 0
3: 15
4: 96
Right 1069629073 10:69886913-69886935 TCAGAGATTGCCCAACTGCTAGG No data
1069629072_1069629076 10 Left 1069629072 10:69886893-69886915 CCACAAAGATTAGGGGATGCTCA 0: 1
1: 0
2: 0
3: 15
4: 96
Right 1069629076 10:69886926-69886948 AACTGCTAGGAGAAGCCTGCTGG No data
1069629072_1069629077 23 Left 1069629072 10:69886893-69886915 CCACAAAGATTAGGGGATGCTCA 0: 1
1: 0
2: 0
3: 15
4: 96
Right 1069629077 10:69886939-69886961 AGCCTGCTGGCTAGAGTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069629072 Original CRISPR TGAGCATCCCCTAATCTTTG TGG (reversed) Intronic
900468929 1:2841556-2841578 TGAGCATCCCTTTATATTTTGGG + Intergenic
902669330 1:17961734-17961756 TGAGCTCACCCAAATCTTTGAGG + Intergenic
904301312 1:29556610-29556632 TGAGCATCCCCTCCTCCATGAGG - Intergenic
905336570 1:37248578-37248600 TGAGCATCCCCTATGCTCAGGGG + Intergenic
907380794 1:54086228-54086250 TGAGCATCCCCTAAGGTTAGGGG + Intronic
910366689 1:86472955-86472977 TGAGAATCCACAAATCTTTGAGG - Intronic
911808411 1:102242001-102242023 TGAACTTCCCCAAATCTTAGTGG + Intergenic
913276376 1:117142262-117142284 TGAGCATCCCCAGATGTCTGTGG + Intergenic
913613239 1:120529314-120529336 TAAGCATCCTCAAATCTTTTGGG - Intergenic
914577948 1:148992933-148992955 TAAGCATCCTCAAATCTTTTGGG + Intronic
916123137 1:161546992-161547014 TGAGCATCCTTTAATCCTTTAGG - Intronic
918699449 1:187589521-187589543 TGAGCAGTCCCTAAACTTTTTGG - Intergenic
919646196 1:200097089-200097111 TGAGCATGCACTGTTCTTTGAGG - Intronic
922217786 1:223534617-223534639 TGAGCTTCACCTTGTCTTTGAGG - Intergenic
1063818398 10:9805368-9805390 GGAGGATCCCCTAATGTTTAGGG - Intergenic
1066990823 10:42511672-42511694 TGAGCATCCCCTGATCTGAGAGG + Intergenic
1069629072 10:69886893-69886915 TGAGCATCCCCTAATCTTTGTGG - Intronic
1076221937 10:128740859-128740881 TCAGCCTCCTCTCATCTTTGGGG + Intergenic
1078597490 11:12700769-12700791 TGAAACTCCCCTAATATTTGAGG + Intronic
1078936092 11:15951415-15951437 TGAGCATCCACAAATGTTTATGG - Intergenic
1084868723 11:72081104-72081126 TAAGCATCCCCAAATCTGTATGG - Intronic
1094747655 12:33364164-33364186 TCAGCATTCCCTAATCTTTTTGG - Intergenic
1098000249 12:65934085-65934107 TGAGAATTCCCTATTCTTTGAGG - Intronic
1101916645 12:108901196-108901218 TGAGCACCACGTAACCTTTGAGG + Intergenic
1102483271 12:113238623-113238645 AGAGCCTTCCCTAACCTTTGAGG + Intronic
1116653802 14:47626785-47626807 TGAGCATCCCCCACCCTCTGTGG + Intronic
1120846069 14:89126125-89126147 TGAGGAACCCCCAATCTTGGAGG - Intronic
1122378921 14:101287726-101287748 AGAGCATCCCATTTTCTTTGTGG + Intergenic
1122415668 14:101548483-101548505 TGAGCATCTCCTAATGCGTGCGG + Intergenic
1138530577 16:57632139-57632161 TGAGCAACCCCACATCTTTGGGG + Intronic
1139029425 16:62861016-62861038 TGAACATTTTCTAATCTTTGAGG + Intergenic
1148543404 17:48498174-48498196 TTAACATCCGCTAATGTTTGGGG - Intergenic
1150482195 17:65519139-65519161 TGAGCATCTCATAATTTTTCAGG - Intergenic
1151472578 17:74327126-74327148 TCCTCATCCCCTAATTTTTGAGG + Intronic
1203170598 17_GL000205v2_random:145123-145145 TGATCATCACCTGATATTTGTGG - Intergenic
1157030895 18:43906806-43906828 TAGGCATCCCCTTATGTTTGGGG + Intergenic
1157332544 18:46714269-46714291 TGAGCATCCCCTAATCTAATGGG + Intronic
1158299578 18:56036293-56036315 AAATTATCCCCTAATCTTTGTGG + Intergenic
1164758916 19:30713105-30713127 GGAACATCCCCTCTTCTTTGTGG + Intronic
925241748 2:2337426-2337448 TGAGGATCCTCAAATCTTTATGG - Intergenic
926112690 2:10193036-10193058 TGAGCAGCCCCTAGTCTTACAGG + Intronic
927145939 2:20166645-20166667 TGAGCATCCACAAATTTTTGAGG - Intergenic
927341625 2:21990060-21990082 TCAGCAGTCCCTAATCTTTTTGG - Intergenic
932171866 2:69564857-69564879 TGATCATCCCCAAAGCTTTGAGG - Intronic
936346750 2:111681303-111681325 TGACCATCCCCTACTGTATGAGG - Intergenic
936430899 2:112462067-112462089 TGAGCCCCTGCTAATCTTTGTGG + Intergenic
942496473 2:176545389-176545411 ACAGCATCCACTAATCTTTGGGG + Intergenic
1171065063 20:22007348-22007370 TGAGCCCACCCTGATCTTTGTGG - Intergenic
1172147548 20:32767293-32767315 TGAGTATCCCTTAATATTGGCGG - Intronic
1172158243 20:32844863-32844885 TGTGTATCCCCTGCTCTTTGGGG + Intronic
1174737561 20:52979722-52979744 TTAGCATCCCAGAATATTTGAGG - Intronic
1175289327 20:57863601-57863623 TGAGCATAGCCTGAACTTTGGGG + Intergenic
1175409591 20:58757842-58757864 TGTGCATCCACTTTTCTTTGCGG + Intergenic
1175646044 20:60672681-60672703 TGTGCATCCCATTCTCTTTGAGG + Intergenic
1177662420 21:24102805-24102827 TGAGCATCCTGCAGTCTTTGAGG + Intergenic
1178995418 21:37394785-37394807 TGAGTATCCCATAACCTTTTTGG - Intronic
1181093274 22:20488861-20488883 AGAGCCTCCCCTACTCCTTGTGG - Intronic
1182573349 22:31255500-31255522 TGAGAATCCCTTTATCTTTCTGG - Intronic
1184222431 22:43109797-43109819 TGCCCCTCCCCTAATCTCTGAGG + Intergenic
1185383561 22:50521465-50521487 TGTGCATCCCCTACTCCTTTGGG + Intronic
950033304 3:9866097-9866119 TGAGAAGCTCCTACTCTTTGGGG + Intergenic
950054870 3:10016411-10016433 TGAGAAGCTCCTACTCTTTGGGG + Intergenic
955482485 3:59403528-59403550 TGAACATCCCCTTCTGTTTGGGG - Intergenic
958791209 3:98653470-98653492 TGAGCACCCCCTATTCATTATGG + Intergenic
969139863 4:5059212-5059234 TGAGCAGCCCCAAATCTCAGTGG - Intronic
970147909 4:13056331-13056353 TGAGCATCTCCAAAGTTTTGAGG - Intergenic
970522894 4:16903358-16903380 CGAGCATGGCTTAATCTTTGGGG - Intergenic
977301469 4:95272555-95272577 TGATCATCCCATACTTTTTGGGG - Intronic
981090420 4:140726377-140726399 CAAGCATCCCCTAATTCTTGAGG - Intronic
982508863 4:156254773-156254795 TGAGGATCCACTAACATTTGAGG + Intergenic
982672831 4:158342754-158342776 TGTTCATCCCCTACTGTTTGAGG - Intronic
986395245 5:7322688-7322710 TCAGCATCTCCTGATATTTGGGG - Intergenic
988117521 5:26916398-26916420 AGAGTATCCCCTTATCTGTGGGG + Intronic
992372038 5:76153215-76153237 TGAGCTTCCTCTCATCTTAGTGG + Intronic
1001974345 5:175984619-175984641 TAATCATCCCCTAATCTTTCTGG + Intronic
1002243089 5:177859160-177859182 TAATCATCCCCTAATCTTTCTGG - Intergenic
1008836725 6:55841209-55841231 ACAGCAGCCCCTAACCTTTGTGG - Intronic
1010339995 6:74738770-74738792 AGAGAATCCCATAAACTTTGTGG + Intergenic
1011860615 6:91751290-91751312 TAAGCATCTCCTATTCTTTTTGG + Intergenic
1012732740 6:102902441-102902463 TAAGCATCCCATAAGCTCTGGGG + Intergenic
1015730857 6:136346753-136346775 TTATAATCCCCTCATCTTTGAGG - Intronic
1015956946 6:138609079-138609101 TCAGCATTTCTTAATCTTTGGGG - Intronic
1016097176 6:140052574-140052596 GGAACATCCCCTAGGCTTTGTGG + Intergenic
1017795566 6:157841315-157841337 TGTGCCTCTCCTAATCATTGGGG - Intronic
1020362858 7:7348325-7348347 TTAGCATCTCCTAATCTTAAGGG - Intergenic
1023915467 7:44585440-44585462 TGAGCATTCCCTCATCTCTCTGG + Intergenic
1025158472 7:56631198-56631220 TGAGCATCCATTTCTCTTTGTGG + Intergenic
1025728133 7:64087063-64087085 TGAGCACCCATTTATCTTTGTGG - Intronic
1028319802 7:89446046-89446068 TGAGCATCCACTAACACTTGTGG + Intergenic
1028880557 7:95875135-95875157 TCAGCTTCCCATAATGTTTGGGG + Intronic
1030149551 7:106389641-106389663 TGAGAATACCTTAAGCTTTGAGG - Intergenic
1033360948 7:140638790-140638812 CAAGCATCACCTAATCTGTGGGG + Intronic
1037736965 8:21575475-21575497 TGAGCTTCCCTTGATCTTAGAGG - Intergenic
1038461129 8:27717990-27718012 TAAGCATCCCTAAATGTTTGGGG - Intergenic
1041495467 8:58481220-58481242 TCAGTATCCCCTAATATTGGCGG + Intergenic
1043098186 8:76002909-76002931 TGAGCATCCCACAACATTTGTGG - Intergenic
1046714867 8:117556485-117556507 TGAGCCTCTGTTAATCTTTGAGG + Intergenic
1048908489 8:139111483-139111505 TTCGGATCCCCTAAACTTTGGGG + Intergenic
1050131381 9:2416090-2416112 AGAGGATCCCCAAAACTTTGAGG - Intergenic
1061270462 9:129537838-129537860 TGATCATGCCCTAATCTTGATGG + Intergenic
1203435533 Un_GL000195v1:133553-133575 TGATCATCACCTGATATTTGTGG + Intergenic
1186660134 X:11661159-11661181 TGAGCTTCTCCTAATTCTTGTGG - Intronic
1187182097 X:16952584-16952606 TGCGCATGCCCTCACCTTTGGGG + Intronic
1188608646 X:32067981-32068003 TAAGCATCCCCTTGTCTCTGCGG + Intronic
1196902883 X:120403214-120403236 TCAGCAGCCCCTAACCTTTTTGG + Intergenic
1200845712 Y:7829858-7829880 TGAGCATCCATTTATCTTTTTGG + Intergenic
1200969988 Y:9141825-9141847 TGAGAATCCCTCAATCTTTATGG - Intergenic
1202141017 Y:21722422-21722444 TGAGAATCCCTCAATCTTTATGG + Intergenic
1202145848 Y:21781376-21781398 TGAGAATCCCTCAATCTTTATGG - Intergenic
1202269680 Y:23059965-23059987 TGAGCATCCGTTTATCTTTGTGG - Intergenic
1202422674 Y:24693711-24693733 TGAGCATCCGTTTATCTTTGTGG - Intergenic
1202448115 Y:24976375-24976397 TGAGCATCCGTTTATCTTTGTGG + Intergenic