ID: 1069629076

View in Genome Browser
Species Human (GRCh38)
Location 10:69886926-69886948
Sequence AACTGCTAGGAGAAGCCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069629072_1069629076 10 Left 1069629072 10:69886893-69886915 CCACAAAGATTAGGGGATGCTCA 0: 1
1: 0
2: 0
3: 15
4: 96
Right 1069629076 10:69886926-69886948 AACTGCTAGGAGAAGCCTGCTGG No data
1069629071_1069629076 11 Left 1069629071 10:69886892-69886914 CCCACAAAGATTAGGGGATGCTC 0: 1
1: 0
2: 0
3: 8
4: 88
Right 1069629076 10:69886926-69886948 AACTGCTAGGAGAAGCCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069629076 Original CRISPR AACTGCTAGGAGAAGCCTGC TGG Intronic
No off target data available for this crispr