ID: 1069629134

View in Genome Browser
Species Human (GRCh38)
Location 10:69887300-69887322
Sequence TAGTGGGTTGGGAGGGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 767
Summary {0: 1, 1: 0, 2: 3, 3: 87, 4: 676}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069629134_1069629149 26 Left 1069629134 10:69887300-69887322 CCATCTTCCCTCCCAACCCACTA 0: 1
1: 0
2: 3
3: 87
4: 676
Right 1069629149 10:69887349-69887371 ATCACACAAAGTGAGAGGGATGG 0: 1
1: 0
2: 0
3: 25
4: 339
1069629134_1069629141 0 Left 1069629134 10:69887300-69887322 CCATCTTCCCTCCCAACCCACTA 0: 1
1: 0
2: 3
3: 87
4: 676
Right 1069629141 10:69887323-69887345 ACCACAGTGAGTGTCCCCCAAGG 0: 1
1: 0
2: 0
3: 13
4: 160
1069629134_1069629147 21 Left 1069629134 10:69887300-69887322 CCATCTTCCCTCCCAACCCACTA 0: 1
1: 0
2: 3
3: 87
4: 676
Right 1069629147 10:69887344-69887366 GGACGATCACACAAAGTGAGAGG 0: 1
1: 0
2: 0
3: 2
4: 70
1069629134_1069629148 22 Left 1069629134 10:69887300-69887322 CCATCTTCCCTCCCAACCCACTA 0: 1
1: 0
2: 3
3: 87
4: 676
Right 1069629148 10:69887345-69887367 GACGATCACACAAAGTGAGAGGG 0: 1
1: 0
2: 0
3: 3
4: 94
1069629134_1069629150 27 Left 1069629134 10:69887300-69887322 CCATCTTCCCTCCCAACCCACTA 0: 1
1: 0
2: 3
3: 87
4: 676
Right 1069629150 10:69887350-69887372 TCACACAAAGTGAGAGGGATGGG 0: 1
1: 0
2: 0
3: 15
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069629134 Original CRISPR TAGTGGGTTGGGAGGGAAGA TGG (reversed) Intronic
900217505 1:1489633-1489655 AAGGGATTTGGGAGGGAAGAGGG - Intronic
900288110 1:1911455-1911477 TGGTGTGTTGGAAGGGCAGAGGG - Intergenic
900760026 1:4464120-4464142 CAGTGGGGTTGGAGGGAAGGAGG - Intergenic
901134395 1:6983747-6983769 TAGAGGGTTGGGTGGGTAGATGG + Intronic
901412223 1:9092509-9092531 TGGTGGGTTGGGAAAGAAGGGGG - Intergenic
901578215 1:10218148-10218170 TAGTGGGTTGGCACGGAAGTGGG - Intronic
902337307 1:15760907-15760929 CAGTGGGACGGGAGGGAAGCCGG + Intronic
902584321 1:17428811-17428833 AAGTGAGGTGAGAGGGAAGATGG + Intronic
902854440 1:19190579-19190601 GAGTGGGTTGAATGGGAAGATGG - Intronic
903066684 1:20703585-20703607 TAATGGGGTGGGTGGGAAGGTGG + Intronic
903254219 1:22082108-22082130 TAGTGGTTGGGGAGGGACTAAGG + Intronic
904079102 1:27860937-27860959 TAAGGGGTTGGGAGTGAGGAGGG - Intergenic
904563051 1:31411603-31411625 TAGTGGGTTGGGGGTGAGGGTGG + Intronic
904621073 1:31775672-31775694 TTGGGTGTTGAGAGGGAAGATGG - Intergenic
904699258 1:32348606-32348628 GGCTGGGCTGGGAGGGAAGATGG - Intergenic
904825074 1:33269015-33269037 TACAGGGTGGGGAGAGAAGAGGG - Intronic
904912983 1:33949334-33949356 CAGTGGCTGGGGAGGGCAGATGG + Intronic
904921513 1:34011856-34011878 TTGTGAGTGGGGAGGGAGGAGGG - Intronic
904926492 1:34053025-34053047 AAGTGGCTTTGGAAGGAAGAGGG + Intronic
905241781 1:36586282-36586304 TCGTGGGAGGGGAGGGGAGAAGG + Intergenic
906064161 1:42968311-42968333 TAGTGGGTTCAGATGGATGATGG - Intergenic
906189529 1:43887425-43887447 AAGTGGGTTTGGAGTGTAGAAGG + Intronic
906468703 1:46108743-46108765 TGGTGGGTGTGGAGGCAAGAAGG - Intronic
906927043 1:50128830-50128852 TAGTGGGTAAAGAAGGAAGATGG + Intronic
907157364 1:52346591-52346613 GGGTGGGATGGGAGGGCAGAGGG + Exonic
907186318 1:52612136-52612158 CAGTGGGTATGGAGGGAGGAAGG - Intergenic
907430811 1:54410192-54410214 AAGTGAGGTGGGAGTGAAGACGG + Intronic
909472882 1:76049317-76049339 GAGGGGGGAGGGAGGGAAGAAGG - Intergenic
909778256 1:79511402-79511424 TTGTGGGGTGGGGGGGAGGAGGG - Intergenic
909779940 1:79531785-79531807 TAGGGGGTGGGGAGTGAAGGTGG - Intergenic
909867425 1:80690964-80690986 CAGGTGGTTAGGAGGGAAGAAGG + Intergenic
910030772 1:82719967-82719989 TAGGGGGTTGGGAGGGAGGTGGG - Intergenic
910649294 1:89547798-89547820 TAGTGGGCGGGGAGGGGAGGGGG + Intronic
910975848 1:92904790-92904812 TAGTGGGGTGGACGGGAAGTGGG - Intronic
911110470 1:94178742-94178764 TAGTGGGTACTGAAGGAAGATGG + Intronic
911495726 1:98628789-98628811 TAGTGAGTGGGAAAGGAAGAAGG + Intergenic
911950554 1:104168569-104168591 TAATGGGTTGGGTTGGAGGAAGG + Intergenic
912432963 1:109639193-109639215 AAGTTGGTTGGGAGAGAAGCAGG + Intergenic
912474680 1:109928028-109928050 TACTGGGTAAGGAGGGAAGATGG - Intronic
912573401 1:110641796-110641818 GTGTGTGTAGGGAGGGAAGATGG + Intergenic
912702412 1:111888135-111888157 CTGTGGGGTGGGAGGGAAGAGGG + Intronic
913163873 1:116168110-116168132 CAGTGGGCGGGGAGAGAAGAAGG + Intergenic
913335000 1:117701518-117701540 GAGGGCATTGGGAGGGAAGATGG - Intergenic
913337116 1:117718600-117718622 TAGTGGGGTGGGAGGGTGGGAGG - Intergenic
914276585 1:146130043-146130065 TAGGGTGTGGGGAGGGAGGAGGG - Intronic
914342702 1:146773899-146773921 CAGTGTGATGGGAGGGAAGCAGG - Intergenic
914537630 1:148580998-148581020 TAGGGTGTGGGGAGGGAGGAGGG - Intronic
914586545 1:149067451-149067473 TAGGGTGTGGGGAGGGAGGAGGG - Intronic
914667988 1:149847929-149847951 TAGTGGGTTTGGAGAGAGCATGG + Intronic
914810302 1:151022888-151022910 TGGTGAATTGGGAGGGAGGAGGG + Intronic
914827293 1:151145475-151145497 TTGGGGGTTGGGTGGGAAGGAGG - Intronic
914986715 1:152464319-152464341 TGGTGGGGGGGGAGGGGAGAGGG - Intergenic
915262211 1:154685136-154685158 TAGCGGGTTAGGTGGGCAGAAGG + Intergenic
915266517 1:154722059-154722081 TTGTTTGTAGGGAGGGAAGAGGG - Intronic
915476673 1:156156597-156156619 GTGTGGGCTGGGAGTGAAGAGGG + Intronic
915601204 1:156924253-156924275 TGCTGGGTTGGAAAGGAAGACGG - Intronic
915935513 1:160088104-160088126 TTGGGGGTTGGATGGGAAGATGG + Exonic
916287187 1:163121099-163121121 TACTGGGGTAGGAGGGAAGAAGG + Intronic
916602243 1:166304385-166304407 TTGTGGGTGGGGCGGGAAGCGGG + Intergenic
916959915 1:169878937-169878959 TAGTGGGTAGGGAGGAAGGTAGG - Intronic
917387756 1:174495563-174495585 TGGTGGGTTGGGGAGAAAGAAGG - Intronic
917416931 1:174820285-174820307 TATTGGGTTGGGGAGTAAGAGGG + Intronic
917420382 1:174857026-174857048 TGTTTGGTTGGGTGGGAAGAAGG - Intronic
917808432 1:178635057-178635079 GGGTGGCTTGGGAGAGAAGACGG - Intergenic
918020283 1:180681045-180681067 TAGAGGCTGGGAAGGGAAGAGGG + Intronic
918064639 1:181090868-181090890 GCCTGGGTTGGGAGGGAAGTGGG + Intergenic
918276919 1:182961720-182961742 TTGGGGGTTGCCAGGGAAGAGGG + Intergenic
919104385 1:193130717-193130739 TAGTGGGATGGTAAGGATGAAGG - Intronic
919244607 1:194964741-194964763 CACTGGGATGGGAGGGAAGGGGG + Intergenic
919705345 1:200670024-200670046 CAGTGGCTTGGGAGGGAGGGAGG + Intergenic
920284835 1:204871925-204871947 TTGTTGGTTGGGAGGGAAAAAGG + Intronic
920442463 1:205990023-205990045 TAGGGTGTGGGGAGGGAAGCTGG - Intronic
920550188 1:206854097-206854119 TAGGGGGTTTGGGGGGAAGGGGG + Intergenic
920840560 1:209550357-209550379 GAGGGGGCTGGAAGGGAAGATGG - Intergenic
920849998 1:209622353-209622375 GAGTGGGTGGGGAGGGCAGACGG + Intronic
920867814 1:209767978-209768000 TAGGGGGTTGGTGGGGAGGAGGG - Intronic
921326481 1:213989581-213989603 TAGTGAGGAGGGCGGGAAGAGGG + Intronic
921440113 1:215175641-215175663 GAGTGGGAAGGGAGGGAAGGGGG - Intronic
922473238 1:225889197-225889219 TAGGGAGTGGGGAGGGAAGGAGG + Intronic
923356829 1:233164865-233164887 TAGAGGCTGGGGAGGGGAGAAGG + Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
924383973 1:243486462-243486484 TACTGGGGTGGGAAGGAGGAAGG - Intronic
924464842 1:244290617-244290639 CAGTGGGTAGGGAGGAAAGAAGG + Intergenic
924517563 1:244779427-244779449 TTGTGGGTGGGGAGCCAAGAGGG - Intergenic
924790971 1:247247824-247247846 TGAGGGGTTGGGAGGGAAGTAGG - Intergenic
1062822403 10:544532-544554 TAGTGGGAGGGGAAGGAAAATGG - Intronic
1063282198 10:4642435-4642457 TAGTGGGGTTGGGGGGTAGATGG + Intergenic
1063497585 10:6524743-6524765 AAGTGGGTGAGGAGGGAGGAGGG + Intronic
1063717184 10:8539696-8539718 TTGTAGGTTGGGAAGAAAGATGG + Intergenic
1064078180 10:12287022-12287044 TACTTGGTTTGGAGGGAAAAAGG - Intergenic
1064183838 10:13143043-13143065 CAGGGGGTAGGGAAGGAAGATGG - Intergenic
1064341649 10:14491003-14491025 CAGTGACTTGGGAGGGAGGAGGG + Intergenic
1064391819 10:14948862-14948884 GAATGAGTTGGGAGGTAAGAGGG + Intronic
1064467619 10:15600456-15600478 TAGTGTGTTGGGAGGAGAAACGG + Intronic
1064599062 10:16974776-16974798 GAGTGGGTTGGGGAGGAAGAGGG - Intronic
1064736008 10:18382532-18382554 TGGTGGGTGGGGAAGGGAGAAGG - Intronic
1064823516 10:19367267-19367289 TAGAGGCTTGGAAGGGTAGAAGG - Intronic
1065061040 10:21900891-21900913 TCAGGGGTTGGTAGGGAAGAAGG - Intronic
1065097492 10:22296181-22296203 TAGTGTAGAGGGAGGGAAGAGGG - Intergenic
1065382391 10:25103158-25103180 GGGGGGGTTGGGAGAGAAGAGGG - Intergenic
1065673171 10:28144495-28144517 CAGTGGCTTGCGAAGGAAGAAGG - Intronic
1065997622 10:31074102-31074124 TTGTGGATGTGGAGGGAAGACGG - Intergenic
1066198803 10:33127009-33127031 TAGTGGGGTGGGGTGGCAGAGGG - Intergenic
1066227943 10:33402911-33402933 TAATGGGGTGGGAGGGGTGAAGG + Intergenic
1067429977 10:46236497-46236519 GTGTGAGCTGGGAGGGAAGATGG - Intergenic
1067443668 10:46327314-46327336 GTGTGAGCTGGGAGGGAAGATGG + Intronic
1067732871 10:48825104-48825126 CAGTGGGTGGGGTGGGGAGAGGG - Intronic
1067785448 10:49242406-49242428 CAGTGAGTTGGTAGGGAAGCCGG - Intergenic
1067957416 10:50807494-50807516 GAGGGGCTTGGGAGGTAAGAAGG - Intronic
1068168341 10:53360072-53360094 TAGGGGATTGGGAGGGAGGTGGG - Intergenic
1069455874 10:68553393-68553415 TAGTGGATTGGAAAGGCAGAGGG + Intergenic
1069541311 10:69296181-69296203 TTGGGGAATGGGAGGGAAGAGGG - Intronic
1069629134 10:69887300-69887322 TAGTGGGTTGGGAGGGAAGATGG - Intronic
1070485332 10:76924989-76925011 AGCTGGGTTGGGAGGGAAGAGGG - Intronic
1070559681 10:77556758-77556780 TATTGTGTGCGGAGGGAAGATGG - Intronic
1070731347 10:78830835-78830857 TGGGAGGTTGGGAGTGAAGAGGG - Intergenic
1071971415 10:90911501-90911523 TAGGGGGTGGGGTGGGAGGAAGG + Intergenic
1072831663 10:98664349-98664371 TTGTGGGCTGGCAGGGAAGCAGG + Intronic
1073838927 10:107475894-107475916 TAGAGGGTTTGAAGGGAAAAAGG - Intergenic
1074241417 10:111643075-111643097 TCGTGGGGTGGGGGGGAGGAGGG + Intergenic
1074293392 10:112158867-112158889 TGGTGGGATGGAAGGGATGAGGG - Intronic
1075278693 10:121119701-121119723 TTGTGGGGTGAGAGGGAAGAAGG - Intergenic
1075278954 10:121122359-121122381 TAATGGGTTGGGATGAGAGAAGG - Intergenic
1075461155 10:122617367-122617389 CTGTGGGTTGGGTGGGAGGAAGG + Intronic
1075926190 10:126253684-126253706 TTGTGGGTTGGGTGGGGGGAGGG + Intronic
1075975730 10:126692429-126692451 TAGGGGCTTGGGAAGTAAGAAGG + Intergenic
1076088373 10:127656490-127656512 TAGTGGGCTGGGAGGAAGGGGGG - Intergenic
1076138986 10:128064679-128064701 TAGGAGGTTGTGGGGGAAGATGG - Intronic
1076708083 10:132313087-132313109 TGGTGGGATGGGAGGTCAGACGG + Intronic
1076794283 10:132791205-132791227 AGGTGGGGTGGGAGGGGAGAGGG + Intergenic
1077278932 11:1733267-1733289 TGGTGGGATGGGAGGGCAGGAGG - Exonic
1077362567 11:2147215-2147237 AAGTGGGTAGAGAGGGAAAAAGG - Intronic
1077388424 11:2286973-2286995 TTATGAGTTGGGAGGGGAGATGG - Intergenic
1077464668 11:2728046-2728068 GAGTGGCTGGGGAGGGAGGAGGG - Intronic
1077587064 11:3461989-3462011 AACTGGGTTAGGAGGGAAGCTGG + Intergenic
1077823151 11:5772371-5772393 TAGTGGGTTGGGGTGGGAGCTGG - Intronic
1077998683 11:7475664-7475686 TATTGGGTGAGGAGGGGAGAAGG + Intergenic
1078721234 11:13885050-13885072 TACAAGTTTGGGAGGGAAGATGG + Intergenic
1078754001 11:14191443-14191465 AAGTGTGTGGGGAAGGAAGAAGG - Intronic
1079822527 11:25148423-25148445 TAGAGGGGAGGGAGGGAAGGAGG + Intergenic
1079949339 11:26782934-26782956 CAATGGGGTGGGAGGGATGAAGG - Intergenic
1080454697 11:32407649-32407671 TCGAGGGTGGGGAGAGAAGAGGG - Intronic
1080944619 11:36957620-36957642 AAGTGTGTTGGGAGGGAAGTGGG + Intergenic
1080972465 11:37294841-37294863 TAGAGGGTCAGGAGGGGAGAGGG + Intergenic
1081279285 11:41188146-41188168 TTGTGTGTTGGGTGGGAGGAGGG - Intronic
1081806768 11:45895141-45895163 AAGTGGGGCGGGAGGGATGATGG + Intronic
1082794597 11:57370064-57370086 AAGGGGCATGGGAGGGAAGAGGG + Exonic
1083150442 11:60788711-60788733 TAGTGGGGTGAGTGGGCAGAGGG - Intronic
1083295872 11:61715455-61715477 CAGGGGGATGGGGGGGAAGAAGG - Intronic
1084473463 11:69376147-69376169 TAGTGGGTGGGGTGGGGAGTTGG - Intergenic
1084829930 11:71760941-71760963 AACTGGGTTAGGAGGGAAGCTGG - Intergenic
1084862113 11:72025884-72025906 TTGTGGGTGGGTAGGGAAAATGG - Intronic
1085083839 11:73653798-73653820 GAGTGGGTAAGGAGGGAAGGAGG + Intronic
1085389242 11:76174060-76174082 TAGCTGGTAGAGAGGGAAGAGGG + Intergenic
1086089584 11:82992250-82992272 TAGTGTGGGGGGTGGGAAGAAGG - Intronic
1086597868 11:88595402-88595424 TAGAGGGTAGGAAGGGAAGGAGG - Intronic
1087271260 11:96114415-96114437 TTCTGAGTGGGGAGGGAAGAGGG - Intronic
1088469546 11:110178030-110178052 TGGTGGGTGGGGAGGGCAGATGG - Intronic
1088587553 11:111372834-111372856 TTGTGTGTTGGGAGGGAGAAGGG + Intronic
1088596453 11:111444459-111444481 TGGGGGGCTGGGAGGGAAGGTGG + Intronic
1088757351 11:112896942-112896964 TTGTGGGGTGGGGGGGAGGAGGG - Intergenic
1090114629 11:123955489-123955511 CAGGGGGTTGGGTGGGAGGAAGG + Intergenic
1090226405 11:125074620-125074642 GAGTGGGGTGGGAGGGGAAAGGG + Intronic
1090378694 11:126309869-126309891 GAAGGGGTTGGGAAGGAAGATGG - Intronic
1090430602 11:126642974-126642996 TGGATGGATGGGAGGGAAGAAGG - Intronic
1090589366 11:128248868-128248890 TAGTAGGTTTTGAGAGAAGAGGG + Intergenic
1090743910 11:129691926-129691948 TAGTGGGTTTTGAGGGAACTGGG - Intergenic
1090931547 11:131302011-131302033 TTGTGGGTTGGGTGGGAAAGGGG + Intergenic
1091081570 11:132673907-132673929 TAGTGGGTTAGGAGAGAAAAGGG - Intronic
1091207027 11:133828756-133828778 GAGTGGGGAGGCAGGGAAGAAGG + Intergenic
1091809323 12:3381854-3381876 TAGGGAGGTGGGAGGGAAGTGGG - Intronic
1092057047 12:5516313-5516335 TTTTCGGTTGGGAGGGGAGAGGG - Intronic
1092118136 12:6024094-6024116 GAGTGGGTTGTGAGGACAGATGG - Intronic
1092229699 12:6769712-6769734 GAGATGATTGGGAGGGAAGATGG - Intronic
1092413305 12:8270736-8270758 AACTGGGTTAGGAGGGAAGCTGG + Intergenic
1092846492 12:12589698-12589720 TAGTGGGTTGTGCGGAAGGAAGG + Intergenic
1092846623 12:12590226-12590248 TGGTGGGTTGTGTGGGAGGAAGG + Intergenic
1093777129 12:23089095-23089117 TTGTGGGGTGGGGGGGAGGATGG - Intergenic
1094199592 12:27781921-27781943 GAGTGGGATGAGAGGGGAGAAGG + Intronic
1094536672 12:31327262-31327284 TAGAGGGTGGGGAGAGAGGAAGG + Intergenic
1094640960 12:32275334-32275356 CAGTGGTTTGGGAGTGAGGATGG + Intronic
1095502207 12:42852382-42852404 TAGAGGGTGGGAAGGGTAGAGGG + Intergenic
1095814536 12:46406985-46407007 AAGTGGGTGGGGAGGGAAGATGG - Intergenic
1096493035 12:52023375-52023397 GAGTGGGGTGGGAGCGCAGAGGG + Intronic
1096981906 12:55732947-55732969 GATAGGGATGGGAGGGAAGAAGG + Intergenic
1097260921 12:57719874-57719896 TATTGGGTAGGGCGGGAAGATGG + Intronic
1097706177 12:62870649-62870671 TAATGGATTAGGAGGGAATATGG + Intronic
1098240153 12:68458682-68458704 TTGGGGGGTGGGAGGGAAGGTGG + Intergenic
1098251799 12:68577833-68577855 AAGTGGTTTTGGAGGGAGGAGGG - Intergenic
1098384230 12:69901845-69901867 TAATGGGGTGGGAGGGTAGTGGG - Intronic
1098569327 12:71971035-71971057 TAGAGGGTTGGGGAGGAGGAAGG + Intronic
1098838878 12:75455045-75455067 TAGTGGCTTGGGAGGGAGCATGG - Intergenic
1098953767 12:76667987-76668009 TGGTGGGAGGGGAAGGAAGAGGG - Intergenic
1099021339 12:77408228-77408250 TAGTGGATTGGAAGAGAACATGG - Intergenic
1100585816 12:95978281-95978303 TAGTGAGTTCTGAGGTAAGACGG + Intronic
1101018247 12:100524823-100524845 ATGTTTGTTGGGAGGGAAGATGG - Intronic
1101638305 12:106565878-106565900 AAGGGGGTAGGGAGGGAGGAAGG + Intronic
1101898338 12:108772170-108772192 AAGTGGGCAGGGAGAGAAGAGGG + Intergenic
1102457891 12:113082205-113082227 GCGTGGGTGGGGAGGGATGAGGG - Intronic
1102543490 12:113638460-113638482 TAGGCGGGTAGGAGGGAAGAAGG + Intergenic
1102708528 12:114904923-114904945 TAGTGAGATGGGAGAGAAGTGGG + Intergenic
1102732096 12:115120631-115120653 TTGAGGGTGGGGGGGGAAGAGGG + Intergenic
1103132839 12:118483633-118483655 TGGTGGGTTGGGAAAGAAGAGGG + Intergenic
1103933914 12:124465358-124465380 TAGTGGCTTGACTGGGAAGATGG + Intronic
1103946270 12:124528434-124528456 GAATGGGCTGGGATGGAAGAGGG - Intronic
1104143309 12:126008766-126008788 TACTGTGATGGTAGGGAAGATGG - Intergenic
1104414827 12:128589404-128589426 GTGTGGGTTGGGAGGGAGGCAGG - Intronic
1104415269 12:128592698-128592720 TAGGGGATGGGGAGAGAAGATGG + Intronic
1106062777 13:26310943-26310965 TTGTGGGTGGGTAGGGAGGAGGG - Intronic
1106191773 13:27459724-27459746 TGGTGGGTTGGGGGGGAAGCCGG + Intergenic
1106506871 13:30378165-30378187 GAGCGGGTTTGGAGAGAAGATGG + Intergenic
1106770532 13:32957191-32957213 AAGCGGGTTGGGAGAAAAGATGG - Intergenic
1106842404 13:33698263-33698285 TAGGGGTTAGGGTGGGAAGAGGG - Intergenic
1109351864 13:61192968-61192990 TGGTGGGTTGGGTGTGAATAAGG + Intergenic
1110474000 13:75891941-75891963 TGGTGGGTTTGGAGAGAGGAGGG - Intergenic
1110499890 13:76214890-76214912 TTGTGGGGTGGGGGGGAGGAGGG - Intergenic
1110614478 13:77525917-77525939 TTGTGAGTGGGGAGGGAACAAGG + Intergenic
1111882044 13:93969710-93969732 TAGAGGGGAGGGAGGGATGAAGG - Intronic
1112114895 13:96341005-96341027 TACAGTGTTGGGAGGGAAGATGG + Intronic
1112823945 13:103370097-103370119 TAGTTGATTGGGGTGGAAGATGG + Intergenic
1113056681 13:106275601-106275623 TTCTGGGTTAGGAGGCAAGAAGG - Intergenic
1113738479 13:112694570-112694592 TAGAGGCATGGAAGGGAAGAGGG - Intronic
1114647591 14:24264187-24264209 TAGTGGGAAGGAAGGAAAGAAGG - Intronic
1114988815 14:28262948-28262970 TTGAGGGTTCGCAGGGAAGATGG - Intergenic
1115820723 14:37210101-37210123 TAGTGTGCTGTGAGAGAAGAGGG - Intronic
1115880889 14:37916983-37917005 TATTGGGATGAGAGGGAAGAAGG + Intronic
1115926628 14:38442966-38442988 GAGTGGGAAGGGTGGGAAGAGGG - Intergenic
1116890654 14:50264727-50264749 AAGTGGGGAGGGAGGGAGGAAGG + Intronic
1117207646 14:53460463-53460485 TCGTGGCATGGGAGGGTAGAGGG + Intergenic
1117416707 14:55503090-55503112 CAGTGGGTGGGGAGGCAAGCTGG + Intergenic
1118113839 14:62752052-62752074 TTGTTGGTTGGAAGGGATGAAGG - Intronic
1118333528 14:64832754-64832776 TGGTGTGATGAGAGGGAAGAAGG - Intronic
1118888970 14:69891544-69891566 CAGGGGGTAGGGAGGGAAGAGGG - Intronic
1119415018 14:74464164-74464186 TTGTGGGTAGGGAGTGAAAAAGG + Intergenic
1120228597 14:81818500-81818522 TGGTGGGTGGAGAGAGAAGAAGG + Intergenic
1121047072 14:90796110-90796132 CAGCTGGTTGGGAGGGAAGCTGG - Intronic
1121167072 14:91813430-91813452 TAGCAAGTTGGGTGGGAAGAAGG - Intronic
1121948048 14:98142055-98142077 TAGCACTTTGGGAGGGAAGAGGG + Intergenic
1121975092 14:98396098-98396120 TTGGGGGTGGGGAGTGAAGAGGG - Intergenic
1122100553 14:99406045-99406067 TAGTAGTTTGGGTGGGAGGAGGG - Intronic
1122438010 14:101712318-101712340 CAGTGGGTGGGGAGAGATGACGG - Intergenic
1122438130 14:101712750-101712772 TGGTGGGTGGGGAGAGATGACGG - Intergenic
1122438204 14:101713002-101713024 CAGTGGGTTGGGAGAGATGACGG - Intergenic
1122438397 14:101713710-101713732 CAGTGGGTGGGGAGAGATGACGG - Intergenic
1122706505 14:103625260-103625282 AAGAGGGTGGGGAGGAAAGAGGG - Intronic
1123457028 15:20435633-20435655 TGGTGGGTGGGGAGGGAAAAAGG - Intergenic
1123661034 15:22564726-22564748 TGGTGGGTGGGGAGGGAAAAAGG + Intergenic
1123989224 15:25671051-25671073 TAGTGGGAAGGGAGGGGATAAGG + Intergenic
1124035322 15:26048991-26049013 GTGTGGGGTGGGAGGGGAGAGGG - Intergenic
1124263182 15:28210786-28210808 TGGTGGGTGGGGAGGGAAAAAGG - Intronic
1124314835 15:28658960-28658982 TGGTGGGTGGGGAGGGAAAAAGG + Intergenic
1124329294 15:28795371-28795393 TAGAGTTTTGGGAGGGAAGGTGG + Intergenic
1124955781 15:34359505-34359527 CACTGGGCTGGGAGGGAACAAGG - Intronic
1125282995 15:38063031-38063053 GAGTGGGTAGGGAGAGAAGTGGG - Intergenic
1125408828 15:39383513-39383535 TAGTGGGTAAGGTGGGAAAAGGG + Intergenic
1125542917 15:40481533-40481555 TGGTGGGGAGGGAGGGGAGATGG - Intergenic
1127469826 15:59280981-59281003 TAGTGGGTTGGAGGTGAGGATGG - Intronic
1128467963 15:67928608-67928630 TAATGGGGTGGGTGGGAAGTAGG - Intergenic
1128667069 15:69546334-69546356 TGGTGGGTTGGGAGGGAATGGGG + Intergenic
1129164607 15:73769310-73769332 GGGTGGGGTGGGAGGGTAGACGG + Intergenic
1129442153 15:75589024-75589046 GAGTGGGAGGGGAGGGGAGAGGG + Intergenic
1130148212 15:81291730-81291752 TAATGGGGAGGGAGGGAGGAAGG + Intronic
1130229637 15:82086856-82086878 TGGAGGGTTGGGATGGGAGATGG + Intergenic
1130246709 15:82258012-82258034 GTGTGGGTTGGGAGGGAAGCTGG - Intronic
1130453956 15:84085334-84085356 GTGTGGGTTGGGAGGGAAGCTGG + Intergenic
1131097138 15:89663329-89663351 TGGGGGGTGGGGAGGGAAGATGG - Intergenic
1131155618 15:90073407-90073429 TTGGGGGTTGGGAGGGCAGGCGG + Intronic
1131224067 15:90609324-90609346 GAGTGGGGTGTGTGGGAAGAGGG + Intronic
1131456880 15:92588540-92588562 TATTCTGTTGGGAGGGAAGCTGG - Intergenic
1131470907 15:92696048-92696070 CAGTGGGTTTTGAGGGAAAAGGG + Intronic
1131935969 15:97505336-97505358 AAGTTAGTTGGGAGGGAGGAGGG - Intergenic
1132106521 15:99066752-99066774 TAGTGGGCTTGGAGGGTAGGTGG + Intergenic
1132148015 15:99439979-99440001 TGGTGGCTTGGCAGGAAAGACGG - Intergenic
1133354516 16:5126241-5126263 AACTGGGTTAGGAGGGAAGCTGG + Intergenic
1133402449 16:5498641-5498663 TAGGCTGTTGGGAGAGAAGATGG + Intergenic
1134031781 16:10998034-10998056 CAATGGGATGGGAGGGAGGATGG - Intronic
1136014141 16:27384048-27384070 GTGTGGGTGGGGAGGGCAGAGGG - Intergenic
1136105278 16:28025774-28025796 CAGTGTGTTGGGACAGAAGAGGG + Intronic
1136375738 16:29864039-29864061 AAGGTGCTTGGGAGGGAAGAAGG + Intergenic
1137029004 16:35505585-35505607 TCATGGGTTGGGAGGGACCAAGG + Intergenic
1137236615 16:46623427-46623449 AACTGGGCTGGGAGAGAAGATGG - Intergenic
1137454069 16:48604938-48604960 AAGTGGGGTGGTCGGGAAGAGGG - Intronic
1137515637 16:49141083-49141105 CACTGGGGTGGGAGGGAGGACGG - Intergenic
1137742175 16:50789459-50789481 GAGTGGGTAGGGAGGGATCAGGG + Intronic
1138678626 16:58669567-58669589 GAGTGGGTTGTGGGGGAAGAGGG + Intronic
1138989870 16:62378001-62378023 AAGTGGGGTGGGAGAGAGGAGGG - Intergenic
1139991282 16:70941429-70941451 CAGTGTGATGGGAGGGAAGCAGG + Intronic
1141501473 16:84447416-84447438 TGGTGGGGAGGGAGGGAAGAAGG - Intronic
1141579339 16:84986559-84986581 GAGAGGGCTGGGAGGGAGGAAGG - Intronic
1141841090 16:86574582-86574604 AAGTGGGCGGGGAGGGAAGGAGG + Intergenic
1141852029 16:86652990-86653012 CAGAGGGTCTGGAGGGAAGAAGG - Intergenic
1141881812 16:86865312-86865334 CAGGGGGTTGGGTGGGAAGGCGG - Intergenic
1142068146 16:88074417-88074439 CAGTGGGTTGGGAGGGTAGGGGG + Intronic
1142130420 16:88429430-88429452 TAGTGGGTGGGGAGGGAGTGGGG - Exonic
1142159288 16:88548315-88548337 TGGTGGGTGGGGCAGGAAGAGGG - Intergenic
1143278376 17:5731456-5731478 AGGTGGGATGGGAGGGAAGGAGG + Intergenic
1143309006 17:5972892-5972914 GATGGGGTTGGGAGGGTAGAGGG - Intronic
1144059994 17:11574760-11574782 CAGTGGGATTGGAGGGAAGATGG + Intergenic
1144066313 17:11627717-11627739 AAGTGGGAGGGGAGAGAAGAGGG - Intronic
1144669086 17:17121803-17121825 GAGTGGGGAGGGTGGGAAGAGGG - Intronic
1145043892 17:19597057-19597079 GTGTGAGTTGGGAGGGCAGAAGG + Intergenic
1146441295 17:32897326-32897348 GAGAGGGGAGGGAGGGAAGAAGG - Intergenic
1146550627 17:33777496-33777518 TGGTGGGCTGGGAGGGAGGTGGG - Intronic
1146833636 17:36091946-36091968 TTGTGGGTTCAGAGGAAAGAGGG + Intergenic
1147237913 17:39071372-39071394 GGGTGGGTTGGGAGGGAACTAGG + Intronic
1147394491 17:40131135-40131157 TAGTTTGTTTGGAGGGAGGAGGG + Intronic
1147988649 17:44320438-44320460 TGGTGGGGTGGGCGGGGAGAGGG + Intronic
1148450893 17:47777303-47777325 TAGTGGGATGGGAGTGAGGTGGG + Intergenic
1149180276 17:53928079-53928101 TAGTGGGTTGAGGGGGAAGTGGG - Intergenic
1149342429 17:55700538-55700560 AAGTGGTTTGGGGTGGAAGATGG - Intergenic
1150602679 17:66664197-66664219 TGGTGGTTTGGGAGGCAGGATGG + Intronic
1150855663 17:68750149-68750171 TAGTTGTTTGCGAGGGAAGACGG + Intergenic
1150871445 17:68916129-68916151 TAGTGGGGTGGTGGGGAAGGGGG + Intronic
1150947615 17:69765406-69765428 GAGAGGGAGGGGAGGGAAGAAGG - Intergenic
1151153617 17:72109055-72109077 GAGTGGGTTAGAAAGGAAGAGGG - Intergenic
1151167044 17:72213075-72213097 TAGTGGGTGGGGTGGGGAGTAGG - Intergenic
1151190997 17:72397945-72397967 AAGAGAGTTGGGAGAGAAGAGGG + Intergenic
1151345212 17:73497263-73497285 CAGTGTCTTGGGAGGAAAGAGGG - Intronic
1152542248 17:80982227-80982249 TAGTGGGGAGGGAGGGAAGGTGG - Intergenic
1153256436 18:3176506-3176528 TAGTGTGTTGGGACGCAAGAAGG + Intronic
1153260472 18:3219071-3219093 GAGTACGTTGGGAGGAAAGATGG + Intronic
1154518709 18:15202485-15202507 TAGTGTGTTTGAAGGGGAGAGGG - Intergenic
1155788088 18:29927281-29927303 TTGTGGGTTTGGAGAGAAAAAGG + Intergenic
1155883814 18:31183320-31183342 TAGAGGGGTAGGAAGGAAGAGGG - Intergenic
1156226889 18:35118303-35118325 CAGTGGATTGGGAGGGAAACCGG + Intronic
1156257601 18:35412414-35412436 TGGAGGATTGGGAGTGAAGAAGG + Intergenic
1156673226 18:39496184-39496206 AAGTGGGTAGAGATGGAAGAAGG - Intergenic
1157523428 18:48361036-48361058 TAGAGGCTAGGGAGGGAGGAAGG + Intronic
1157749106 18:50162284-50162306 TTGTGGGTAGGGAGGGAGGGAGG - Intronic
1159023435 18:63161759-63161781 TAGTGCGTCAGGTGGGAAGACGG - Intronic
1159590763 18:70332721-70332743 TTGGGGGTGGGGAGGGTAGAGGG - Intergenic
1160337440 18:78054951-78054973 TGGGGGGTTGGGAAGGCAGATGG + Intergenic
1160409855 18:78667993-78668015 GGGTGGGATGGGAGGGCAGATGG - Intergenic
1160412271 18:78683183-78683205 TGCGGGGTTGGGAGGGAAGGGGG + Intergenic
1160710002 19:547094-547116 GAGGGGGATGGGAGGGATGAAGG + Intronic
1161131359 19:2590805-2590827 TAGTTGGTTGGGTGGGCGGATGG - Intronic
1161197223 19:2993652-2993674 TAGAGGGTTGGGTGGGGAGCTGG - Intronic
1161258896 19:3324720-3324742 TAGTGGGAAGAGAGGGAAGAAGG - Intergenic
1162740277 19:12770084-12770106 TAGGGGAGTGGGAGGGAAGGGGG + Intronic
1162955055 19:14092828-14092850 AAGTGGGCTGGGAGGGCTGAGGG + Exonic
1162958242 19:14111810-14111832 CAGTGGGTGGGGAGGGTGGAGGG + Intronic
1163374935 19:16924249-16924271 AAGTGGGTTTGGGGGGAAGATGG + Intronic
1163732091 19:18955063-18955085 TAGTTGGATGGATGGGAAGATGG - Intergenic
1164483752 19:28637232-28637254 TTGTGGGATGGGTGGGAAGATGG + Intergenic
1164623695 19:29713201-29713223 AAGTGGGTGAGGAGGGAGGATGG + Intronic
1164811786 19:31163220-31163242 TAGATGGGTGGGAGGGTAGATGG + Intergenic
1165311042 19:35029838-35029860 GAGTGGAGTGGGAGGAAAGAGGG + Intergenic
1165351267 19:35277281-35277303 TATTGGTTTTGGAGGAAAGAGGG + Intronic
1165487667 19:36105158-36105180 AAGTGGGGAGGGAGGGTAGAAGG + Intergenic
1165789226 19:38481516-38481538 TGGGGGGTTGGGAAAGAAGAAGG - Intronic
1166633049 19:44424856-44424878 GAGTGGGTTGGTAGGGGAGATGG - Intronic
1167062958 19:47162584-47162606 TAGGGGGTGGGGAGGGTAGAGGG - Intronic
1167429459 19:49446253-49446275 GTGGGTGTTGGGAGGGAAGAGGG - Intergenic
1202676819 1_KI270711v1_random:14728-14750 TAGGGTGTGGGGAGGGAGGAGGG - Intergenic
925041499 2:734635-734657 TAATGGGTTGCCATGGAAGAGGG + Intergenic
927258492 2:21061835-21061857 CAGTGAGATGTGAGGGAAGAGGG + Intergenic
927799324 2:26083423-26083445 TTGGGGGAGGGGAGGGAAGAGGG - Intronic
927827551 2:26319121-26319143 AGATGGGATGGGAGGGAAGAGGG + Intronic
928430948 2:31218046-31218068 AAGTAGGTTGGGAAGGAAGAGGG - Intronic
928626300 2:33143028-33143050 TAGAGGATTGGGGTGGAAGAAGG - Intronic
930636728 2:53814462-53814484 TAATGGGTAGGGTGAGAAGATGG - Intronic
931094001 2:58919422-58919444 GATTGGGTTGGTAGGGGAGAAGG - Intergenic
931248788 2:60512504-60512526 TTCTGGGTTGGGAGGGGAGCCGG - Intronic
932093753 2:68828953-68828975 AAGGAGTTTGGGAGGGAAGAGGG - Intergenic
932142012 2:69287392-69287414 ATGTGGGTAGGGAGGGAACAGGG - Intergenic
932476443 2:72009307-72009329 TAGTGGCTGGGGTGGGAGGAGGG - Intergenic
932688795 2:73895053-73895075 TGATAGGTTGGGAGGGAAGAGGG + Intronic
932875067 2:75442805-75442827 AAGTGGGAAGGGTGGGAAGAGGG + Intergenic
934491577 2:94764832-94764854 TAGGGTGGTGGGAGGGTAGAGGG - Intergenic
935373962 2:102376682-102376704 TGGTGGGAGGGGAGGGATGATGG + Intronic
935571178 2:104661253-104661275 TGGTGGGTAGGTAGGGAAGGGGG + Intergenic
935883169 2:107587164-107587186 TTGTGGGGTGGGGGGGAGGAGGG + Intergenic
936561611 2:113543418-113543440 GAGAGGGTTGGGAAGGAAGGAGG - Intergenic
937190202 2:120088433-120088455 GAGTGGGGAGGGTGGGAAGAGGG + Intronic
937332026 2:121037650-121037672 TGGTTGGATGGGAGGGAAGTTGG - Intergenic
937347752 2:121137174-121137196 CAGAGGCTTGGGAGGGCAGAGGG - Intergenic
937847344 2:126595453-126595475 TAGTGGTTGGGAAAGGAAGATGG - Intergenic
937982098 2:127621958-127621980 TGGTGGGTGAGGAGGGGAGAAGG - Intronic
938652795 2:133401063-133401085 TAGAGGGTTGGGAGGTGAAAGGG + Intronic
938841348 2:135167744-135167766 TAGAGGGATGGGAAGGAACAAGG - Intronic
938904539 2:135825816-135825838 CTGTGGGCTGCGAGGGAAGAGGG - Intronic
939207924 2:139132022-139132044 TACTAGGTGGGGAGGGAAGGAGG - Intergenic
939356911 2:141114425-141114447 CAGTGGGGTGGAAGGGAAGCTGG + Intronic
940336000 2:152528398-152528420 TAGGGCCTTGGGAGGGAACAAGG - Intronic
940502885 2:154516511-154516533 AAGTTGGTTGGGAAGGAAGCAGG - Intergenic
941163791 2:162063803-162063825 TGGTAGGTTGGCAGGGATGAGGG + Intronic
942241571 2:173967103-173967125 AAGTGGACTGGGAGGGAGGAAGG + Intergenic
942251841 2:174053894-174053916 TAGGGGGCGGGGAAGGAAGAGGG + Intergenic
942331359 2:174828048-174828070 CCCTGAGTTGGGAGGGAAGAGGG + Intronic
942545468 2:177058764-177058786 AAGTGGATTGGTAGTGAAGATGG + Intergenic
942674928 2:178416688-178416710 TATTGGGATGGGAGACAAGAGGG - Intergenic
943657968 2:190529323-190529345 CAGTGGGCTGGGAGGGAAGGTGG - Intronic
944923914 2:204443342-204443364 TGGATGGATGGGAGGGAAGATGG + Intergenic
945027017 2:205629427-205629449 TAGGGGGTCGGGAGGCAAGATGG - Intergenic
945043372 2:205761104-205761126 TGTTGGCTTGGGAGGGTAGAGGG + Intronic
945696046 2:213105573-213105595 TAGTGTGTGGGGGGGGAAGGGGG + Intronic
945988082 2:216371076-216371098 TAGAGGTTTGGGAAGGAAAAAGG + Exonic
946077832 2:217090076-217090098 TGGAGGGTAGGGAGGGAGGACGG + Intergenic
946179987 2:217943180-217943202 TAGTGGTTGGAGAGGGCAGAGGG + Intronic
946651283 2:221894524-221894546 CAGTAGATTGGGAGGGGAGAGGG - Intergenic
947740250 2:232481672-232481694 TGGTGGGTGGGGAGGGGAGGGGG - Intronic
948299898 2:236897118-236897140 TAGAGGTTTGGGAAGGAGGAGGG + Intergenic
948504060 2:238415916-238415938 TCATGGGTGGGGAGGGTAGAGGG + Intergenic
948760477 2:240187238-240187260 AAGTGGGGTGGGAGGGAGGAAGG + Intergenic
948925821 2:241096651-241096673 TAAAGGGGTGGGAGGGAAAAGGG + Intronic
1168909706 20:1438088-1438110 TAGTGGGGAGGGAGGGAGGGAGG + Intergenic
1169206592 20:3744123-3744145 GACTGGGATGGGAGGTAAGAGGG + Intronic
1169297013 20:4408731-4408753 GAGTGGGTTGTGAGGCTAGAAGG - Intergenic
1170096441 20:12650609-12650631 TAGTGGGTTTCCAGGGGAGATGG + Intergenic
1170188552 20:13620001-13620023 TAGAGTTTTGGGAGGGAAGGTGG - Intronic
1170747281 20:19111459-19111481 CAGTGGGTGGGGAGAGAGGAAGG + Intergenic
1171201580 20:23246204-23246226 TAGTGGGTCAGGATGAAAGAGGG - Intergenic
1171232739 20:23500506-23500528 TGGTGGAATGGGAGGCAAGAGGG + Intergenic
1171236439 20:23529210-23529232 GAGTGGTTTGGCAGGGAAAATGG + Intergenic
1171500656 20:25590456-25590478 TATTGGAATGGGAGGGAAGAAGG - Intergenic
1172007433 20:31827014-31827036 TGGAGGGATGGGAGGGCAGAGGG - Intronic
1172035884 20:32010490-32010512 TGGGAGGTTGGGAGGGACGAAGG + Intronic
1172179009 20:32989402-32989424 GGGTGGGGTGGGAGGGAACACGG - Intronic
1172280437 20:33703983-33704005 TAGGGGTTGGGGAGGGCAGAGGG - Exonic
1172298315 20:33829878-33829900 TAGTAGATAGGAAGGGAAGAAGG + Intronic
1172299999 20:33842710-33842732 TACAGGGCTGGGAGGGAAGAGGG - Intronic
1172374811 20:34429911-34429933 TAGAGGAATTGGAGGGAAGAAGG + Intronic
1172586098 20:36085985-36086007 TGGTGGGTGGGGAGGGGAGGTGG + Intergenic
1173075577 20:39815868-39815890 GAGTTGGTGTGGAGGGAAGAAGG - Intergenic
1173239529 20:41281961-41281983 TAGGGTGCTGGCAGGGAAGATGG + Intronic
1173416049 20:42856855-42856877 TAGGATGTTGGGAGGGAAAAAGG + Intronic
1173661152 20:44734668-44734690 GAGGGGGTTGAGAGGGTAGAGGG - Intergenic
1173870565 20:46339379-46339401 TAGTGGGTAGGAGGGGAAGCAGG + Intergenic
1174467391 20:50728793-50728815 TTGGGGGTGGGGAGGGATGATGG + Intergenic
1175238161 20:57526810-57526832 GAATGGGTAAGGAGGGAAGAAGG + Intergenic
1175322086 20:58095379-58095401 TAGTGTGTTGGGAGGGGTGGGGG + Intergenic
1175660041 20:60804522-60804544 TTGTGGGTCAGGAAGGAAGAGGG + Intergenic
1176304476 21:5115965-5115987 CAGTGGGTGGGGAGGGCCGAGGG + Intergenic
1176949722 21:15030726-15030748 TAGGTGGTAAGGAGGGAAGAAGG + Intronic
1177140501 21:17352989-17353011 TAGTGAGTTGTCAGGGAAGCAGG - Intergenic
1177649248 21:23939443-23939465 TGGTGGGGTGGGAGGAAGGAGGG - Intergenic
1178721601 21:35015438-35015460 TAATGGGTTTGGAAGGATGAAGG + Intronic
1178765756 21:35449625-35449647 TACTGGGTTGAGAGGGGAGAGGG + Intronic
1178769239 21:35487249-35487271 GAGTGGGTAGGGAGGGCAGAAGG + Intronic
1178965698 21:37115029-37115051 TTGTGAGGTGGGAGGGGAGAGGG + Intronic
1179452713 21:41476473-41476495 TGGGGGCGTGGGAGGGAAGAAGG - Intronic
1179852580 21:44146065-44146087 CAGTGGGTGGGGAGGGCCGAGGG - Intergenic
1180049308 21:45324120-45324142 CTGAGGGTTGGGAGGGAGGAGGG - Intergenic
1180131204 21:45828419-45828441 TACTGGGGTGGGAGGGCAGTGGG - Intronic
1180177544 21:46097976-46097998 GAGGGGGATGGGAGGGAAGCGGG - Intergenic
1180569568 22:16702511-16702533 GAGTGGGTTGTGAGGACAGATGG - Intergenic
1180694827 22:17744924-17744946 GAGAAGGGTGGGAGGGAAGATGG + Intronic
1181534274 22:23533675-23533697 TACTGGCTTGAGAGGGAAGAGGG + Intergenic
1181938693 22:26458009-26458031 TCATGGGGTGGGAGGGCAGAAGG - Intronic
1181985179 22:26795624-26795646 TATTGGGTTGGCATGGAAAAGGG - Intergenic
1182100706 22:27655648-27655670 TAGAAGGATGGAAGGGAAGAAGG + Intergenic
1182471941 22:30554167-30554189 TAGGGGGCTGGGCGGGTAGAGGG - Intergenic
1182889195 22:33802660-33802682 TGGTGGGTTGAGTGGGGAGAGGG - Intronic
1183093335 22:35538444-35538466 AAGTGGGTGGGGAGGGGGGAAGG + Intergenic
1183263324 22:36810418-36810440 TAGGGGGTTGGGAGTGAGGAAGG + Intronic
1183353517 22:37346393-37346415 GCCTGGGTTGGGAGGGAAGGAGG - Intergenic
1184096712 22:42320016-42320038 TGGTGGGAATGGAGGGAAGATGG - Intronic
1184186547 22:42868872-42868894 AACGGGGTTGGGAGGGAAGGTGG - Intronic
1184262804 22:43329090-43329112 CACTGGCATGGGAGGGAAGAAGG - Intronic
1184690568 22:46115490-46115512 TGGAGGGTAGGGAGGGAAGTGGG - Intergenic
1184998756 22:48228845-48228867 TGCTGGCTTGGGAGAGAAGACGG + Intergenic
949627490 3:5883506-5883528 TAGGGTGATTGGAGGGAAGAGGG + Intergenic
950015869 3:9754575-9754597 TAGAGGGTGGGGAGGTAGGAGGG + Intronic
950087435 3:10270260-10270282 TAGTCGGTGGTGAAGGAAGAAGG - Exonic
950105653 3:10386684-10386706 TGATGGGATGGGAGGGCAGAGGG + Intronic
950794078 3:15496392-15496414 TAGTTGACTGGGAGGGAGGAGGG - Intronic
951068066 3:18290853-18290875 TAGTGGTTTGGGAGTCAAAAGGG - Intronic
951485499 3:23204130-23204152 AAGTGGGGTGGGCGGGAAGGGGG - Intronic
951788542 3:26452615-26452637 TCATGGGTCTGGAGGGAAGAGGG + Intergenic
952869564 3:37886314-37886336 AAGTGGGTCGGGAGGGAAATGGG - Intronic
952947568 3:38489552-38489574 TTGTGGATTGGGAGGAGAGAGGG + Exonic
953389966 3:42528220-42528242 GGGTGGGGTGGGAGGGAAGAGGG - Intronic
953391350 3:42535699-42535721 CAGTGAGTGGGGAGGGATGAGGG + Intronic
954367278 3:50153309-50153331 TACTGGGTTGGGAAGGAAAGAGG - Intergenic
954414248 3:50385182-50385204 AAGGGGGAGGGGAGGGAAGATGG + Intronic
954466501 3:50658266-50658288 AGGTGGGTTTGGAAGGAAGATGG + Intergenic
954916147 3:54149973-54149995 GAGGGGGAGGGGAGGGAAGAAGG - Intronic
955335874 3:58085576-58085598 TAGTGGGTTGAAAGGAGAGAGGG + Intronic
956057843 3:65319318-65319340 TTGGGGGGTGGGAGGGAAGTAGG + Intergenic
956071284 3:65454658-65454680 TTGGGAGTTGGCAGGGAAGAGGG + Intronic
957058405 3:75461926-75461948 AACTGGGTTAGGAGGGAAGCTGG + Intergenic
957889711 3:86340709-86340731 TAGTGGGGTGGGGAGGCAGAAGG - Intergenic
957917005 3:86698223-86698245 TAGGGGGTTGGAGGGGAAGTGGG + Intergenic
958584209 3:96065160-96065182 TGGTAGGTTAGGTGGGAAGAAGG + Intergenic
960708609 3:120505496-120505518 TAGTGGGGGGGGGGGGAACAAGG - Intergenic
960934890 3:122892758-122892780 AAGAGGGAAGGGAGGGAAGAAGG - Intergenic
961063129 3:123849884-123849906 TAGGGTGTGGGGAGGGGAGAGGG - Intronic
961295041 3:125877776-125877798 AACTGGGTTAGGAGGGAAGCTGG - Intergenic
961615779 3:128179657-128179679 TAGTGGCTTGGGCCGGCAGACGG + Intronic
961749735 3:129088125-129088147 AACTGGGCTGGGAGAGAAGACGG - Exonic
963613715 3:147507493-147507515 TTGGGGGGAGGGAGGGAAGAAGG - Intronic
964144847 3:153447298-153447320 TTGTGGGGTGGGGGGGAGGAAGG + Intergenic
964242343 3:154611261-154611283 GAGGGGGAAGGGAGGGAAGAAGG - Intergenic
964450285 3:156805693-156805715 TAGGGAGTGGGGAGGGAAAATGG + Intergenic
964482307 3:157153223-157153245 TAGTTGGTTGGAAGGGAAAATGG - Intronic
965457525 3:168922129-168922151 TTGGGGGTTGGGAGAGAACATGG - Intergenic
965728159 3:171742169-171742191 GACTGGGGTGGGAGGAAAGATGG + Intronic
966086748 3:176077632-176077654 AATTGGGAAGGGAGGGAAGAAGG + Intergenic
966186656 3:177233259-177233281 TAGTGGGCTAGGAAGCAAGATGG - Intergenic
966578074 3:181525924-181525946 AAGTGGGTTGGGGTGGAAGCAGG - Intergenic
966603813 3:181801698-181801720 GAGTGGGGAGGGAGGGAGGAAGG + Intergenic
967493258 3:190117280-190117302 TGGTGTGTTGGAGGGGAAGAAGG - Intronic
967674561 3:192281194-192281216 TAGAGGATTCAGAGGGAAGATGG - Intronic
968039649 3:195578566-195578588 TAGCGGGAGGGGAAGGAAGAGGG - Intronic
968052221 3:195662975-195662997 GGGTGGGTGGGGAGGGTAGATGG - Intergenic
968103589 3:195985363-195985385 GGGTGGGTGGGGAGGGTAGATGG + Intergenic
968282970 3:197490787-197490809 AAGTGGGATGGGAGTGGAGAGGG + Intergenic
968301891 3:197622956-197622978 GGGTGGGTGGGGAGGGTAGATGG + Intergenic
968937071 4:3617143-3617165 GAGAGGGATAGGAGGGAAGAAGG - Intergenic
968937118 4:3617268-3617290 GAATGGGATGAGAGGGAAGAAGG - Intergenic
968937188 4:3617477-3617499 GGGAGGGATGGGAGGGAAGAAGG - Intergenic
969393438 4:6906138-6906160 AAGGGGATTGGGAGGGAGGATGG + Intergenic
969658022 4:8509217-8509239 GAGTGGGGTGGGAGGGAGGGAGG + Intergenic
969927927 4:10602569-10602591 TAGAGGCTTGGGAGGGAGCACGG + Intronic
971511410 4:27429708-27429730 TGGGAGGTTGGGAGGGGAGAAGG + Intergenic
972553439 4:40156493-40156515 TAGTGGGGTGGGAGGCAATTTGG - Exonic
972676146 4:41261433-41261455 GAGTGAGGTGGGAGGGAAAAAGG + Intronic
973869592 4:55152284-55152306 TGGTGGGATGGGAGGGAAGAGGG - Intergenic
975094967 4:70447062-70447084 GGGTGGGTGGGCAGGGAAGAGGG + Intronic
975302718 4:72809622-72809644 GAGTGAGGTGGGAGGGAAGTGGG + Intergenic
975808014 4:78133380-78133402 TAGTGGGGTGGGAGGGAGGTAGG + Intronic
976064414 4:81167664-81167686 TCCGGGGTTGGGAGGGAACATGG + Intronic
976261467 4:83148948-83148970 ATGTGGGTAGAGAGGGAAGAGGG + Intergenic
976667854 4:87619059-87619081 TAGAGGGCTGGGAGTGTAGAAGG - Intergenic
977079745 4:92510053-92510075 TATTGGGTTGGAAGGGTTGAGGG + Intronic
977643412 4:99383458-99383480 TTGTGGAATGGGAGGGAAAAAGG - Intergenic
977754877 4:100656867-100656889 TAGTGAGTTGGTTGGGAGGAAGG + Intronic
977754938 4:100657515-100657537 TAGTGAGTTGGTTGGGAGGAGGG - Intronic
978099801 4:104824198-104824220 CAGAGGGTAGGGAGGGAGGAGGG + Intergenic
978100514 4:104834738-104834760 GAGGGGGTTGGGAGGTGAGATGG - Intergenic
978910146 4:114052728-114052750 TAATGGGTTGGGTTGGAAGAAGG + Intergenic
979483503 4:121245147-121245169 TAGTGGGTTAGGGAAGAAGAAGG + Intergenic
980021465 4:127714894-127714916 TGGTGGGTTGGGTGGGCAGTGGG + Intronic
980473009 4:133273942-133273964 TTGTGGGTGGGGTGGGGAGAGGG - Intergenic
981027140 4:140088201-140088223 AAGTGTGATGGGAGGGAGGAAGG + Intronic
981029312 4:140108117-140108139 TGGTGGGTTGGGAGGGATAGAGG - Intronic
981287291 4:143033234-143033256 TAGTGGATGGGGAGGGAAGTGGG + Intergenic
981342496 4:143637906-143637928 TGGTGGGTGGGGAGAGAAGAAGG + Intronic
982719007 4:158840043-158840065 TAGGGTCTTGGGAGAGAAGAGGG + Intronic
983534156 4:168839564-168839586 TGGTGGGATGGGAGGGGTGAGGG + Intronic
983577821 4:169277179-169277201 TGGAGGGTGGGCAGGGAAGAGGG - Intergenic
983981497 4:174002532-174002554 TACTGAGCAGGGAGGGAAGAGGG - Intergenic
984787372 4:183580795-183580817 TAGGGGGTTGGGAGGGAGCAGGG - Intergenic
985159631 4:187031132-187031154 TTGTGGGATGGGAGGGAGGGGGG - Intergenic
985367954 4:189253397-189253419 GAGTGGGTAGGGTGGGAGGAGGG + Intergenic
985561064 5:586094-586116 GAGAGGGTAGGAAGGGAAGAAGG + Intergenic
985932132 5:3067027-3067049 TGGTTTGTTAGGAGGGAAGATGG + Intergenic
988011963 5:25500438-25500460 TAGAGGGGAGAGAGGGAAGAAGG - Intergenic
988798435 5:34673958-34673980 GAGTGGGTGGGGAGGGTAGGAGG + Intronic
989143453 5:38224761-38224783 TTGTGGGGTGGGGGGGAGGAGGG + Intergenic
989192939 5:38689106-38689128 TAGTGATTTGTGAGGGAGGAGGG - Intergenic
989375212 5:40754053-40754075 CAGTGGTTTGGGTTGGAAGATGG - Intronic
989596115 5:43157749-43157771 TAGTGTCTTGGGAGGGATCATGG - Intronic
990114999 5:52379341-52379363 TGTGGGGTTGGGGGGGAAGAGGG - Intergenic
990627305 5:57628567-57628589 TATTGTGGTGGGAGCGAAGATGG + Intergenic
993223747 5:85137966-85137988 TGGTGGGGTGGGAGGGGGGACGG - Intergenic
993521234 5:88904264-88904286 TAGGGGGTCGGGAGGGGGGAGGG - Intergenic
993929151 5:93916672-93916694 TAGGGGGTTCTGAGGGAAGGGGG - Intronic
994917152 5:105994961-105994983 TAGTGGATTGCTAGGGGAGATGG - Intergenic
996096720 5:119406980-119407002 TAGCAGGGTGGGAGGGGAGAGGG + Intergenic
998167703 5:139853781-139853803 TGGGGGGTTGGGAGGGAGGTGGG + Intronic
998170050 5:139867373-139867395 AAGTGGCATGGGTGGGAAGAGGG + Intronic
999197445 5:149792075-149792097 GAGTGGCCTGGGAGGGAAGGTGG + Intronic
999240703 5:150125741-150125763 TCGTGGGCTCGGAGGGAACAGGG + Intronic
1001157235 5:169283320-169283342 TGGCGGGGTGGGAGGGAAGCAGG + Intronic
1002297032 5:178237531-178237553 TGCTGGGTGGGGAGGGAAAAGGG - Intergenic
1002884611 6:1282274-1282296 TAGTGACTTGGGAGCAAAGATGG - Intergenic
1003458440 6:6306660-6306682 AGGTGGGGTGGGAGGGTAGAAGG + Intronic
1004250784 6:14021726-14021748 GAGGGGGAGGGGAGGGAAGAAGG - Intergenic
1004420063 6:15461264-15461286 TAGGAGATTGGGAGGGAAGGTGG + Intronic
1005582190 6:27245978-27246000 GAGTGAGTGGGGAGGGAGGAAGG - Intergenic
1005961963 6:30700431-30700453 TCGTGGTCTGGGAGGGAAAAGGG + Exonic
1005989021 6:30891956-30891978 GAGGAGGTTGGAAGGGAAGAGGG - Intronic
1006294712 6:33165037-33165059 GGGAGGGCTGGGAGGGAAGAGGG - Intronic
1006412852 6:33885388-33885410 TGGTGGAGTAGGAGGGAAGAGGG - Intergenic
1006815078 6:36844705-36844727 TAGTGCTTTGGGAGGGGTGAGGG - Intergenic
1007485604 6:42178786-42178808 GAATGGCCTGGGAGGGAAGAAGG - Exonic
1008527064 6:52417932-52417954 GAGTGGGTAGGGAGGGATCATGG + Intergenic
1009429441 6:63549797-63549819 TAGAGGCTTGGAAGGGTAGAGGG + Intronic
1009522797 6:64705824-64705846 TTGTGGGGTGGGAGGGAGGGGGG + Intronic
1009560828 6:65240427-65240449 GAGAGGGTTGGGAGGGAAGGAGG - Intronic
1009745405 6:67807088-67807110 TAGTGGCTGGGAAGGGTAGAGGG + Intergenic
1009874825 6:69492980-69493002 AAGTGGGCTGGAAGGGAAAAAGG - Intergenic
1009955096 6:70444154-70444176 TAGTGCTTTGGGAGGGAAGCAGG + Intronic
1012279637 6:97313723-97313745 TAGTGTGTTGGGGGGGTAGGGGG - Intergenic
1012691273 6:102314557-102314579 TACTGGGTGGGGAGGGTGGAAGG + Intergenic
1013105981 6:107027182-107027204 TAGTTGGTTGGGAGGGAAAGGGG + Intergenic
1013215828 6:108026396-108026418 AAGTGGGTGGAGAGTGAAGATGG + Intergenic
1013289080 6:108705506-108705528 GTGTGGGATGTGAGGGAAGAGGG - Intergenic
1013731432 6:113172801-113172823 TTCTGTGTTGGGAGGGGAGAGGG + Intergenic
1013790605 6:113832312-113832334 TAGTGTCTTGGGAGGTAATACGG - Intergenic
1014236897 6:118968070-118968092 TAGAGTGTTGGGAGGTATGAAGG + Intronic
1014719455 6:124898344-124898366 AAGTGGGATGGGAAGGAAGGTGG - Intergenic
1014802839 6:125796318-125796340 TGGGGGGTGGGGAGAGAAGAAGG - Intronic
1014951589 6:127562161-127562183 TGGTGGGAAGGGAGGGAATAGGG + Intronic
1016830102 6:148425698-148425720 GAGGGGGATGGGAGGGGAGAAGG - Intronic
1017081490 6:150673651-150673673 GAGAGGGAGGGGAGGGAAGAGGG - Intronic
1017587081 6:155938269-155938291 AAGTGGGATTGGAGGGAAGGTGG + Intergenic
1018171510 6:161146872-161146894 TTGTGAGGTGGGAGGGAAGACGG - Intronic
1018328556 6:162702482-162702504 TAGTAGGTAGGGAGGGCTGAGGG - Intronic
1018795537 6:167182453-167182475 TAGTGGTTTGTCAGGGGAGAAGG + Exonic
1018820783 6:167372610-167372632 TAGTGGTTTGTCAGGGGAGAAGG - Exonic
1019798714 7:3072000-3072022 CAGTGGGTTGGGAGGGTAGGTGG + Intergenic
1020278062 7:6636840-6636862 TTGTGGGTGGGGAGGGAGGAGGG - Intergenic
1021123147 7:16819717-16819739 GAGTGGGGAGGGAGGGAAGAGGG - Intronic
1021894884 7:25224001-25224023 TAGGGTGCTGGGAGGGAACATGG - Intergenic
1022090002 7:27102004-27102026 GAGTGGGCTGGGAGAGAAGGAGG - Intronic
1022130949 7:27403911-27403933 TGGTGGGGTGGGAGGGAAGGTGG + Intergenic
1022142844 7:27508181-27508203 TTTTGGGTTAGGAGAGAAGATGG - Intergenic
1022804389 7:33807346-33807368 CAGTAGGCTGGGAGGGATGAGGG - Intergenic
1024452208 7:49560245-49560267 TTGTGGGTTGGGGGGGAGGGGGG + Intergenic
1025002742 7:55331123-55331145 GAGTGGGAGGGGAGGGAAGTTGG - Intergenic
1025009170 7:55381963-55381985 TCGCTGGTTGGGAGGGAAGGAGG + Intronic
1026094720 7:67335742-67335764 TAGGGGGTCGGGAGGGGGGAGGG + Intergenic
1026567551 7:71501919-71501941 TAGTGAAATGGGAGGGAAGAAGG - Intronic
1026578740 7:71596531-71596553 TAGTGAAATGGGAGGGAAGAAGG + Intronic
1027217588 7:76193994-76194016 TAGAAGGCTGGGAGGGAGGAGGG + Intergenic
1027229692 7:76265050-76265072 TTGTGGGGTGGGAGGAAGGAGGG - Intronic
1027371832 7:77514320-77514342 ATGTGGTTGGGGAGGGAAGAAGG - Intergenic
1027534411 7:79379105-79379127 TTGTGGGGTGGGGGGGAGGAGGG - Intronic
1027836502 7:83250870-83250892 TAGTGGGTGGGGATGGGGGAGGG - Intergenic
1028262585 7:88684198-88684220 TAGTGGGGTGGGGGTGGAGATGG - Intergenic
1028428103 7:90713553-90713575 TTGTGGGGAGAGAGGGAAGATGG + Intronic
1028600301 7:92593512-92593534 GAGTGGGAAGGGAGGGAAGTGGG - Intergenic
1029177378 7:98674661-98674683 AAGTGGGTGGGGTGGGGAGAGGG - Intergenic
1029875020 7:103741550-103741572 AAGGAGGATGGGAGGGAAGAAGG + Intronic
1030018836 7:105251883-105251905 TCGTGGCTTGAGGGGGAAGAAGG + Intronic
1030698618 7:112614637-112614659 TAGTGGGGAGGGAGGAATGAGGG - Intergenic
1030979841 7:116173599-116173621 GAGGGTGTTGAGAGGGAAGATGG - Intergenic
1031288750 7:119906752-119906774 TAGTAGCTGGGGAGGGTAGAGGG - Intergenic
1031794031 7:126148928-126148950 GAGTAGCTTGGGAGGTAAGAAGG + Intergenic
1031969691 7:128055180-128055202 CAGGGGGTTGGGAGGCAGGAAGG + Intronic
1033718135 7:144024513-144024535 GAGTGGCTTGGGTGGGAAGAGGG - Intergenic
1033843944 7:145409413-145409435 TAGTAGGTGGGGAAGGAAAAGGG - Intergenic
1034002399 7:147430166-147430188 TGGTGAGTTGAGAGGGAAAATGG - Intronic
1034355163 7:150445440-150445462 GAGTGGGTGGGGAGGGGAGAGGG + Intergenic
1035413794 7:158667396-158667418 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413804 7:158667425-158667447 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413934 7:158667800-158667822 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413955 7:158667859-158667881 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413965 7:158667888-158667910 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414003 7:158668002-158668024 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414024 7:158668061-158668083 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414034 7:158668090-158668112 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414086 7:158668233-158668255 TAGTGGGTAAGGAGGGCAGAGGG - Intronic
1035414124 7:158668350-158668372 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035899050 8:3437706-3437728 TAGTGGCTTTGGTGGGAACAGGG - Intronic
1036293721 8:7518136-7518158 CACTGGGTGGGGAGGGGAGAGGG - Intergenic
1036328840 8:7802859-7802881 CACTGGGTGGGGAGGGGAGAGGG + Intergenic
1036374966 8:8192138-8192160 AACTGGGTTAGGAGGGAAGCTGG - Intergenic
1036854577 8:12231013-12231035 AACTGGGTTAGGAGGGAAGCTGG + Intergenic
1036875936 8:12473506-12473528 AACTGGGTTAGGAGGGAAGCTGG + Intergenic
1037835458 8:22212591-22212613 TGTTTGGTGGGGAGGGAAGAAGG + Intergenic
1037886591 8:22599224-22599246 GAGAGGGTGGGGAGGGGAGAGGG - Intronic
1037904265 8:22706188-22706210 CAGTGTGGTGGGAGAGAAGATGG - Intergenic
1038029721 8:23627217-23627239 TAGGGACTTGGGAGGGAGGAGGG + Intergenic
1038267169 8:26046180-26046202 TAGTGGGCGGGGAGGGACGGGGG + Intergenic
1038539119 8:28376647-28376669 TAGTGGGTTTGGGGGAAAGTTGG - Intronic
1038642277 8:29338106-29338128 TGTTGGGTTGGGAGGGAGGAGGG - Intronic
1039245881 8:35607777-35607799 TCATGGCTGGGGAGGGAAGAAGG - Intronic
1039520486 8:38166799-38166821 TCATGGGTTGGGAGGGCAGGTGG - Intronic
1039559741 8:38503658-38503680 GTGTGGGCTGGGAGGGAAAAGGG - Intergenic
1039807483 8:41013267-41013289 AAGGTGGTTGGGTGGGAAGAGGG - Intergenic
1040602479 8:48897911-48897933 CAGTGAGTTGGGAGGAAATATGG + Intergenic
1040869278 8:52083622-52083644 AAGTTGGTAGGGAGGGATGATGG + Intergenic
1041128520 8:54669874-54669896 TGGTGGGGTGGGAGGGAAGGGGG + Intergenic
1041304815 8:56447513-56447535 TGGTGGGGAGGGAGGGATGAGGG + Intergenic
1041537161 8:58939468-58939490 GAGTGGTCTGGGAGGGAAGGAGG + Exonic
1041719588 8:60964138-60964160 GAGGGGGTGGGGAGGGAAGAAGG + Intergenic
1041749702 8:61246949-61246971 GAGTGGGGAGGGTGGGAAGAGGG - Intronic
1042774412 8:72413986-72414008 TAGAGTGTGGGCAGGGAAGATGG + Intergenic
1042884195 8:73530103-73530125 TAGTGAGTTGGAAGGGAACTGGG + Intronic
1044483370 8:92719651-92719673 TAGAGGGTAGGGTGGGTAGAGGG - Intergenic
1045140826 8:99280318-99280340 GAGTGGCTTGGGAGGGAGTAGGG - Intronic
1045198859 8:99958067-99958089 TGGTGGGTAGGGCGGGAGGAGGG - Intergenic
1046873024 8:119224686-119224708 GAGTGGGTGGGGAGAGGAGAAGG - Intronic
1046996210 8:120526735-120526757 TGGTGGGTGGGGTTGGAAGAGGG + Intronic
1047338112 8:123955276-123955298 CAGTGGGTGGGGAGAGAAGGAGG + Intronic
1047364726 8:124201464-124201486 GAGGGGGTGGGGAGGGACGATGG - Intergenic
1047631015 8:126708583-126708605 TTGGGGATTGAGAGGGAAGATGG - Intergenic
1047676633 8:127209562-127209584 GGGAGGGTGGGGAGGGAAGATGG + Intergenic
1048048952 8:130799127-130799149 TGGGGGGTGGGGTGGGAAGAGGG + Intronic
1049032961 8:140050708-140050730 TGGGGGCTGGGGAGGGAAGAAGG + Intronic
1049453662 8:142676147-142676169 CAGTGGGGTGGGTGGGCAGAAGG + Intronic
1049703073 8:144023778-144023800 TAGAGGGTTCTGAGGGAAGAGGG - Intronic
1049703307 8:144024588-144024610 GAGAGGGTTCTGAGGGAAGAGGG - Intronic
1049891071 9:71900-71922 GAGAGGGTTGGGAAGGAAGGAGG + Intergenic
1050800863 9:9612327-9612349 TCGTGGGGTGGCAGGGCAGAGGG - Intronic
1050979541 9:11992394-11992416 TACTGGGTTGGGTGAGAAGTGGG + Intergenic
1050999874 9:12268747-12268769 TAGGGTGTTGGAAGTGAAGATGG - Intergenic
1051170942 9:14317007-14317029 TGGTGAGGAGGGAGGGAAGAAGG - Intronic
1051621751 9:19057408-19057430 TAGTGGCTTCAGAGGGAACATGG + Intronic
1051696567 9:19774188-19774210 TGGTGGGTTGGGGAGGAGGAGGG + Intronic
1051847982 9:21474367-21474389 TGGTGGGGAGGGAGGGAAGGTGG - Intergenic
1052039268 9:23719745-23719767 CACTGGGTAGGGAAGGAAGAGGG + Intronic
1052518917 9:29518177-29518199 GAGTGGGAAGGGAGGGGAGATGG - Intergenic
1052563540 9:30116850-30116872 TAGGGGGTGGGGAGGTAGGAGGG + Intergenic
1053732512 9:41072955-41072977 GAGAGGGTTGGGAAGGAAGGAGG + Intergenic
1054453958 9:65420199-65420221 GGGAGGGATGGGAGGGAAGAAGG + Intergenic
1054454076 9:65420545-65420567 GAGAGGGATAGGAGGGAAGAAGG + Intergenic
1054695919 9:68358620-68358642 GAGAGGGTTGGGAAGGAAGGAGG - Intronic
1054938522 9:70714635-70714657 TCGTGGGGTGGGGGGGAGGAGGG + Intronic
1054940213 9:70732628-70732650 TCGTGGGGTGGGGGGGAGGAGGG + Intronic
1055136504 9:72835136-72835158 GAGGGGGTTGGGGAGGAAGATGG - Intronic
1056125641 9:83534488-83534510 TAGGGGGTGGGGAGGTAACAAGG + Intronic
1056204742 9:84309164-84309186 TGTTGGGTAGGGAGGGTAGATGG + Intronic
1056840796 9:89996662-89996684 GAGTGGGATGGGAGGGTGGAGGG + Intergenic
1057042398 9:91857186-91857208 TAGTTGGATGGGAGGGGAGGAGG - Intronic
1057249921 9:93492902-93492924 AAGTGGGATGGGAGTGAAGCAGG + Intronic
1057398929 9:94705156-94705178 TAGTGGGAGGGGAGGGAAGTAGG - Intergenic
1057611724 9:96550207-96550229 AGGTGGGTAGGAAGGGAAGAGGG - Intronic
1057745234 9:97745858-97745880 TAGTGGGTGAAGAGGAAAGAGGG - Intergenic
1057949290 9:99356912-99356934 GAGGGAGGTGGGAGGGAAGAGGG + Intergenic
1058070514 9:100596945-100596967 TAGTTGGTTGGGAGGGGAGTGGG - Intergenic
1058136576 9:101314297-101314319 TATTGGGGAGGGAAGGAAGAGGG - Intronic
1058603636 9:106697689-106697711 TCAAGGGATGGGAGGGAAGAAGG - Intergenic
1058935229 9:109763769-109763791 ATGTGGGGTGGGAGGGAAGTAGG + Intronic
1059024783 9:110614768-110614790 GAGTGGTTTGGGAGGAAAAATGG + Intergenic
1059059023 9:111015394-111015416 CAGTGGGTTTGGAGGGAAGAAGG - Intronic
1059341620 9:113600670-113600692 TGGTGGGTGGAGAGGCAAGAGGG + Intergenic
1060017333 9:120098154-120098176 CAGAGGGTGGGGTGGGAAGATGG + Intergenic
1060044762 9:120331151-120331173 TGTTGTGTTGGGAGGGAAGATGG - Intergenic
1060188572 9:121578358-121578380 TAGGGGGAGAGGAGGGAAGAGGG - Intronic
1060413668 9:123415956-123415978 TAGTGATTTGGGTGGGAAGAGGG + Intronic
1060417307 9:123440538-123440560 TTGTGGGGTGAGAGGGAACATGG - Intronic
1060481459 9:124018776-124018798 GAGGGGGTAGGGACGGAAGATGG - Intronic
1060776148 9:126376427-126376449 TTGTGGGTTGGGATTTAAGATGG + Intronic
1060868133 9:127016098-127016120 CAGTGGGGTGGCAGGGAAGGAGG - Intronic
1061093278 9:128439035-128439057 TGGAGGGGTGGGAGGGGAGATGG + Intergenic
1061246194 9:129402246-129402268 TACTGGCTTGAGAGGGAAGAGGG - Intergenic
1061485134 9:130916701-130916723 CAGTGGGATGGGAGGACAGAGGG + Intronic
1185680008 X:1880799-1880821 GAGGGGGTAGGGAGGGAAGGAGG + Intergenic
1186190454 X:7062690-7062712 AGGTGGGTGGGGAGGGAAGCTGG + Intronic
1186568983 X:10694594-10694616 TAGTTGGGTGGGAGGGATGGTGG + Intronic
1188441668 X:30219478-30219500 TAATGGGTTGGGAAGGCACAGGG - Exonic
1190686881 X:52882734-52882756 TCATGGGGTGGGAGGGAGGAGGG - Intergenic
1190699101 X:52973058-52973080 TCATGGGGTGGGAGGGAGGAGGG + Intronic
1192261357 X:69507328-69507350 CAGAGGGTTGGGAAGGAAAAGGG + Intronic
1192367511 X:70486486-70486508 TAATGTGTTGGGAGAGTAGAAGG - Intronic
1192525325 X:71838073-71838095 TTGTGGGGTGGGAGGGGGGAGGG - Intergenic
1193365786 X:80630968-80630990 TAGTGGGGTGGGAGGGAATGAGG - Intergenic
1194682616 X:96872242-96872264 AAGTGGGTGGGGAGGGGAAATGG - Intronic
1195505844 X:105656094-105656116 TGGGGGGTTGGGAGGGAGGTAGG - Intronic
1195563467 X:106313216-106313238 AAGTGGGGAGGGTGGGAAGAGGG - Intergenic
1196309651 X:114148609-114148631 CAGTGGGCTGTGAGGGATGAAGG + Intergenic
1196462202 X:115942897-115942919 GAGTGGCTTGGGAGTGAAGTGGG - Intergenic
1196653187 X:118189704-118189726 TAGTAAGATGGGTGGGAAGAGGG - Intergenic
1196700384 X:118661478-118661500 TAGAGGTTGGGGAAGGAAGAAGG - Intronic
1196938075 X:120749383-120749405 AAGTGGGAGGGGAAGGAAGAGGG + Intergenic
1197032435 X:121833588-121833610 GTGAGGGTTGGGAGGGAAGTGGG + Intergenic
1197090824 X:122534492-122534514 TGGGAGGTTGGGGGGGAAGATGG + Intergenic
1197723567 X:129761010-129761032 TGTTGGGTTGGGATGGAGGAGGG - Intronic
1197963404 X:132030401-132030423 TTGGGGAGTGGGAGGGAAGAGGG - Intergenic
1198282975 X:135161004-135161026 TGCTGGGTTGGGAAAGAAGACGG + Intronic
1199288368 X:146078563-146078585 GAGTGGGTAGGGAGAGAATAGGG + Intergenic
1199692112 X:150316637-150316659 TAAGGGGTTGAGAGGGAAAAGGG - Intergenic
1199737062 X:150694130-150694152 TGGGGGGTTGGGAGTGAGGACGG + Intronic
1199963756 X:152801072-152801094 TGGTGGGGAGGGAGGGAGGAAGG - Intergenic
1200184168 X:154170849-154170871 TCGTGGGTCAGGAGGAAAGAAGG - Intergenic
1200189821 X:154207977-154207999 TCGTGGGTCAGGAGGAAAGAAGG - Intergenic
1200195574 X:154245786-154245808 TCGTGGGTCAGGAGGAAAGAAGG - Intergenic
1200201227 X:154282907-154282929 TCGTGGGTCAGGAGGAAAGAAGG - Intronic
1201232021 Y:11874245-11874267 AAGTGGGTTTGAAGGGAAAAAGG + Intergenic
1201438646 Y:13985638-13985660 TGGTGGGTGGGGAGGGAGGAAGG - Intergenic
1201445927 Y:14057070-14057092 TGGTGGGTGGGGAGGGAGGAAGG + Intergenic
1201933565 Y:19380957-19380979 TGTTGGGGTTGGAGGGAAGATGG - Intergenic
1202063177 Y:20909807-20909829 TGGTGGGTTTGGAGAGAAGGGGG + Intergenic