ID: 1069629945

View in Genome Browser
Species Human (GRCh38)
Location 10:69891533-69891555
Sequence TGCAGCGGAGGCAGCTGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069629945_1069629952 12 Left 1069629945 10:69891533-69891555 CCATCACAGCTGCCTCCGCTGCA No data
Right 1069629952 10:69891568-69891590 CCCGCCCCTACCCCATTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069629945 Original CRISPR TGCAGCGGAGGCAGCTGTGA TGG (reversed) Intronic