ID: 1069630328

View in Genome Browser
Species Human (GRCh38)
Location 10:69893678-69893700
Sequence CAGTGGAAACAGCTGGACCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069630321_1069630328 8 Left 1069630321 10:69893647-69893669 CCCAAGGTCTGGCCCAGTTCTGA 0: 1
1: 0
2: 2
3: 15
4: 195
Right 1069630328 10:69893678-69893700 CAGTGGAAACAGCTGGACCTTGG No data
1069630316_1069630328 29 Left 1069630316 10:69893626-69893648 CCAAGTCTAGAAGCCCTGACTCC No data
Right 1069630328 10:69893678-69893700 CAGTGGAAACAGCTGGACCTTGG No data
1069630319_1069630328 16 Left 1069630319 10:69893639-69893661 CCCTGACTCCCAAGGTCTGGCCC 0: 1
1: 0
2: 1
3: 14
4: 207
Right 1069630328 10:69893678-69893700 CAGTGGAAACAGCTGGACCTTGG No data
1069630320_1069630328 15 Left 1069630320 10:69893640-69893662 CCTGACTCCCAAGGTCTGGCCCA 0: 1
1: 0
2: 3
3: 15
4: 186
Right 1069630328 10:69893678-69893700 CAGTGGAAACAGCTGGACCTTGG No data
1069630322_1069630328 7 Left 1069630322 10:69893648-69893670 CCAAGGTCTGGCCCAGTTCTGAG 0: 1
1: 1
2: 2
3: 19
4: 248
Right 1069630328 10:69893678-69893700 CAGTGGAAACAGCTGGACCTTGG No data
1069630325_1069630328 -5 Left 1069630325 10:69893660-69893682 CCAGTTCTGAGCATTTGGCAGTG 0: 1
1: 0
2: 0
3: 14
4: 168
Right 1069630328 10:69893678-69893700 CAGTGGAAACAGCTGGACCTTGG No data
1069630324_1069630328 -4 Left 1069630324 10:69893659-69893681 CCCAGTTCTGAGCATTTGGCAGT 0: 1
1: 0
2: 1
3: 16
4: 167
Right 1069630328 10:69893678-69893700 CAGTGGAAACAGCTGGACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069630328 Original CRISPR CAGTGGAAACAGCTGGACCT TGG Intronic
No off target data available for this crispr