ID: 1069631513

View in Genome Browser
Species Human (GRCh38)
Location 10:69899912-69899934
Sequence GCCCAAGGGCCTAGATGTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069631510_1069631513 -4 Left 1069631510 10:69899893-69899915 CCTGACTCAGGAGTCAGGAGCCC 0: 1
1: 0
2: 1
3: 43
4: 1859
Right 1069631513 10:69899912-69899934 GCCCAAGGGCCTAGATGTTCAGG No data
1069631505_1069631513 22 Left 1069631505 10:69899867-69899889 CCGCAGAGCCTCAAGCAACAATC 0: 1
1: 0
2: 2
3: 26
4: 259
Right 1069631513 10:69899912-69899934 GCCCAAGGGCCTAGATGTTCAGG No data
1069631504_1069631513 27 Left 1069631504 10:69899862-69899884 CCTGACCGCAGAGCCTCAAGCAA 0: 1
1: 0
2: 0
3: 14
4: 156
Right 1069631513 10:69899912-69899934 GCCCAAGGGCCTAGATGTTCAGG No data
1069631507_1069631513 14 Left 1069631507 10:69899875-69899897 CCTCAAGCAACAATCTGGCCTGA 0: 1
1: 0
2: 2
3: 10
4: 175
Right 1069631513 10:69899912-69899934 GCCCAAGGGCCTAGATGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069631513 Original CRISPR GCCCAAGGGCCTAGATGTTC AGG Intronic
No off target data available for this crispr