ID: 1069636146

View in Genome Browser
Species Human (GRCh38)
Location 10:69926065-69926087
Sequence GGCCACCTGGATGCCAGTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 1, 2: 1, 3: 11, 4: 161}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069636146_1069636151 -7 Left 1069636146 10:69926065-69926087 CCATTACTGGCATCCAGGTGGCC 0: 1
1: 1
2: 1
3: 11
4: 161
Right 1069636151 10:69926081-69926103 GGTGGCCGGGGCTCTCTGTCTGG No data
1069636146_1069636157 22 Left 1069636146 10:69926065-69926087 CCATTACTGGCATCCAGGTGGCC 0: 1
1: 1
2: 1
3: 11
4: 161
Right 1069636157 10:69926110-69926132 CTGGCCAGTTATCCTGCCTCAGG No data
1069636146_1069636152 -6 Left 1069636146 10:69926065-69926087 CCATTACTGGCATCCAGGTGGCC 0: 1
1: 1
2: 1
3: 11
4: 161
Right 1069636152 10:69926082-69926104 GTGGCCGGGGCTCTCTGTCTGGG No data
1069636146_1069636154 3 Left 1069636146 10:69926065-69926087 CCATTACTGGCATCCAGGTGGCC 0: 1
1: 1
2: 1
3: 11
4: 161
Right 1069636154 10:69926091-69926113 GCTCTCTGTCTGGGCCCAGCTGG No data
1069636146_1069636158 23 Left 1069636146 10:69926065-69926087 CCATTACTGGCATCCAGGTGGCC 0: 1
1: 1
2: 1
3: 11
4: 161
Right 1069636158 10:69926111-69926133 TGGCCAGTTATCCTGCCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069636146 Original CRISPR GGCCACCTGGATGCCAGTAA TGG (reversed) Intronic
900620330 1:3584106-3584128 GGCACCCTGGATGCCTCTAAGGG - Intronic
901258064 1:7848979-7849001 GAGCACCTGGAAGCCAGTGAGGG - Intronic
901405220 1:9040550-9040572 GGCCACCAGGATGCCTGAACTGG + Intronic
902199444 1:14822793-14822815 GGCCACCGTGATGCCAGGAAAGG - Intronic
903014719 1:20354386-20354408 GGCCTCCTGGCTGCCAGTCCAGG - Intronic
903024178 1:20415480-20415502 GTCCACCTGGATTCCTGCAATGG - Intergenic
904604457 1:31691211-31691233 GGCCACCTGGATCCCCCTGAGGG + Exonic
905594187 1:39191774-39191796 TGCCACCTGGCTGCCATTAGAGG + Intronic
908348057 1:63255917-63255939 GGCCACCTAGAAGGCAGGAAGGG + Intergenic
908901886 1:68965018-68965040 GGCCACCTGGAAGCCAGTCCTGG + Intergenic
910256198 1:85249484-85249506 GGTTACTTGGATGCCATTAAAGG - Intergenic
910427307 1:87130478-87130500 GGCCACCTGTCTGGCAGCAAGGG - Intronic
910697633 1:90037490-90037512 TACCACCTGGATGACAGTGATGG + Intergenic
915689574 1:157675507-157675529 GACCACATGGAAGCCACTAAGGG - Intronic
916883326 1:169043832-169043854 TGCCACCTGGATCCCTGTAGTGG - Intergenic
920187238 1:204167434-204167456 AGACACCTGGGTGCCAGCAAGGG - Intergenic
920187773 1:204172319-204172341 AGACACCTGGGTGCCAGCAAGGG - Intergenic
922865537 1:228858425-228858447 GGCCACCTGGGAGACAGGAAAGG + Intergenic
923912146 1:238460788-238460810 GGCCACCTGGTTTCCATAAACGG + Intergenic
924350776 1:243112646-243112668 AGACATCTGGGTGCCAGTAAGGG + Intergenic
1062927724 10:1329549-1329571 CACCACCTGGATCCCAGCAAGGG - Intronic
1067941611 10:50661358-50661380 GGCCTCTTGGATGGCAGTAGAGG + Intergenic
1069636146 10:69926065-69926087 GGCCACCTGGATGCCAGTAATGG - Intronic
1069755586 10:70772731-70772753 GGCCACCTGGGTGCTAGTCATGG - Intronic
1069869660 10:71525558-71525580 GGCCCCATGGAAGCCAGTAGGGG + Intronic
1070862847 10:79686317-79686339 GGCCTCTTGGATGGCAGTAGAGG + Intergenic
1074048120 10:109857801-109857823 GGCCTCCAGGCTGCCAGGAAGGG + Intergenic
1074186367 10:111102482-111102504 GGCCACCTGAATGCCTGGCAGGG - Intergenic
1075248264 10:120844199-120844221 GACCAACTGTATGCCAGGAAAGG + Intergenic
1075450249 10:122546352-122546374 GGCCACCTGGGGGCCAGCAGAGG + Intergenic
1076214379 10:128681064-128681086 GGGCACATGGCTGCCAGTAGTGG + Intergenic
1076444141 10:130500365-130500387 GCCCACCTGGAAGCCAGGCAGGG + Intergenic
1077392239 11:2305404-2305426 GGACACCTGGATGGAAGAAAAGG + Intronic
1077396328 11:2325005-2325027 GGCCAACTGGAAGCCATTAGAGG + Intergenic
1077753836 11:5004183-5004205 AGCATCCTGGATGCCAGAAAAGG + Intergenic
1082645640 11:55721063-55721085 GGCCACCTGTATGTCCATAATGG + Intergenic
1085705162 11:78780530-78780552 GACCACTTGGATCCCAGTGATGG - Intronic
1088598606 11:111457205-111457227 GGGCACCTTGATGCCTGTGACGG - Intronic
1090872811 11:130762978-130763000 GCCCACCTGGAGGCCAGGAGGGG - Intergenic
1091010974 11:132000129-132000151 GCCCACCTGGAAGCCAGGCAAGG + Intronic
1099711217 12:86227045-86227067 GTCAGCCTGGATGCAAGTAATGG - Intronic
1101053540 12:100888623-100888645 GGCCAACTGGAGGCCTGTGAGGG + Intronic
1101255298 12:102971246-102971268 AGCCACCTGGATGGGAATAAAGG + Intergenic
1101579052 12:106025354-106025376 GGCCACCTGCAAGCCAGGAAGGG + Intergenic
1104268426 12:127260091-127260113 GACCACCTGGAAACCACTAAGGG - Intergenic
1108126590 13:47251354-47251376 GTCCACCTGGAGACCAGAAAGGG + Intergenic
1108729685 13:53221466-53221488 GGCCACCTGGTTAACAATAATGG - Intergenic
1117516972 14:56511620-56511642 GGCCTCCTGGTAGCCAGTACAGG + Intronic
1118747409 14:68784393-68784415 GGCCACCTGCAAGGCAGCAAGGG + Intergenic
1119085321 14:71733690-71733712 GGTCTCCTGGATGTCAGTGAGGG - Exonic
1119119386 14:72059811-72059833 GGCCATCTGCAAGCCAGGAAGGG + Intronic
1120878166 14:89393559-89393581 GGCCACATGGCGGCCAGAAACGG + Intronic
1121843750 14:97155581-97155603 GGCCACCTGGCTTCCAAGAAGGG + Intergenic
1123932897 15:25180404-25180426 GGAGACCAGGATGCCAGGAAGGG - Intergenic
1123946123 15:25239745-25239767 GGACACCAGGGTGCCAGGAAGGG - Intergenic
1128309560 15:66621914-66621936 GGCCACCTGGCCGCCAGCATCGG - Intronic
1129882730 15:79017815-79017837 GGCCACTAGGATGACTGTAAAGG + Exonic
1131748591 15:95479486-95479508 GGCCTCCTGGCTGCTAGTACCGG - Intergenic
1134024038 16:10941427-10941449 GTCTAACTGGATGCCAGGAATGG - Intronic
1135551636 16:23402991-23403013 GGCCATTTGGATTCCAGTTATGG - Intronic
1138189193 16:55000381-55000403 GGCAGCTTGGATGACAGTAAAGG - Intergenic
1139779153 16:69336499-69336521 GGCTACCTGGATGACAGGGATGG + Exonic
1141466735 16:84210985-84211007 GGTCACCTGGCTGTCAGTGATGG - Intergenic
1142000682 16:87662594-87662616 GGCCACCAGGGGGCCAGGAAAGG - Intronic
1142087570 16:88192090-88192112 AGCCACCTGGAAGTCAGGAAGGG + Intergenic
1143970607 17:10792493-10792515 GGTCTCCAGGCTGCCAGTAAAGG - Intergenic
1147156223 17:38545660-38545682 GGCCTCCTACTTGCCAGTAAAGG + Intronic
1147458778 17:40555201-40555223 GGCCACCTGGATGGTGATAAAGG + Exonic
1148117195 17:45183111-45183133 GGCCACTTGGAGGCCAGGACAGG + Intergenic
1148998658 17:51734658-51734680 CACCACCTGGAGGCCAGGAATGG + Intronic
1149259454 17:54863137-54863159 AGCAAACTGTATGCCAGTAAAGG + Intergenic
1152094079 17:78263156-78263178 GGACACCTGGAAGGCAGTAGAGG - Intergenic
1155326896 18:24673330-24673352 GACCACCTGGCTACCAATAACGG + Intergenic
1161327490 19:3670730-3670752 GGCCACCTGGATGCCCTGCAGGG + Intronic
1162145207 19:8609085-8609107 GGCCAACAGGATGTCAGTGAGGG + Intronic
1162439509 19:10683774-10683796 GGCTACATGAATGCCGGTAAGGG + Exonic
1163458134 19:17420619-17420641 GACCCCATGGATTCCAGTAAGGG + Exonic
1166122887 19:40696049-40696071 GGTCACCTGGAAGCAAGGAATGG + Exonic
1166887575 19:45971527-45971549 GACCCCCTGGATGCCTGTGAGGG - Intronic
1167035586 19:46993398-46993420 GGCAGCCTGGCTGCCAGTGATGG + Intronic
1167521493 19:49958604-49958626 GGACACCTGGGTCCCAGGAAGGG - Intronic
1167523882 19:49972117-49972139 GGACACCTGGGTCCCAGGAAGGG + Intergenic
1167756181 19:51415142-51415164 GGACACCTGGGTCCCAGGAAGGG - Intronic
1168290931 19:55357209-55357231 GGGCACCTGGAGGACAGAAAAGG - Intronic
925324166 2:3004287-3004309 GGCAACATGAATGTCAGTAAAGG + Intergenic
925474950 2:4203089-4203111 GGCCAACTGCAAGCCAGTAAGGG - Intergenic
925534794 2:4904850-4904872 GGCAACCTGGATCCCAGTCCGGG + Intergenic
925816154 2:7752527-7752549 GGTCACCTGATTGCCAGAAATGG + Intergenic
930018602 2:46987229-46987251 GGCCACCTGGTTGCCAGAAGGGG + Intronic
931082411 2:58789446-58789468 GGCCATCTGGATGGCATTATGGG + Intergenic
931168485 2:59776921-59776943 TTCCACTTAGATGCCAGTAAGGG + Intergenic
931464662 2:62475706-62475728 GGCCACTTGAATGCCAGTGTCGG + Intergenic
932490393 2:72116297-72116319 GGCCACCTGCAGGCCAGAACAGG + Intergenic
935468234 2:103425349-103425371 GGCCTCCTCGATGACAGAAAAGG - Intergenic
935469808 2:103444591-103444613 AGCCACCTGGATGGCACTTAGGG - Intergenic
937332958 2:121043576-121043598 GGCCATCTGCAAGCCAGGAAGGG + Intergenic
937337172 2:121069167-121069189 GGGCACCTGGAGGCCAGTGGTGG - Intergenic
938628552 2:133139017-133139039 AACACCCTGGATGCCAGTAAAGG + Intronic
940273542 2:151916103-151916125 GGATACCTGGTTGCCAGTGAAGG + Intronic
943108165 2:183572454-183572476 GGCCACGTGGATGCAAGAGAGGG - Intergenic
944547367 2:200811712-200811734 GGCGACGTGGAACCCAGTAAGGG + Intronic
947204508 2:227648025-227648047 GGGGACCTGGATGCCAGCAGTGG - Intergenic
947858928 2:233345063-233345085 GCCCACCTGGAAGCCAGCACTGG - Intronic
949009841 2:241672128-241672150 GGCCACCTGGGTGTGAGTCAAGG - Intronic
1168895095 20:1318880-1318902 GGCCATCTGCAAGCCAGGAAGGG + Intronic
1169217006 20:3799915-3799937 GGCCATATGGCTGCCAGGAAAGG - Intronic
1170762040 20:19259546-19259568 GGCCACATGGCAGCCAGTCATGG + Intronic
1175419694 20:58823457-58823479 GGCCATCTGTATGCCTGTGACGG + Intergenic
1176911250 21:14567659-14567681 GGACACCAGGACGCCAGGAATGG - Intronic
1178616079 21:34133990-34134012 GGCCACCTGGTGGGCAGTACAGG - Intronic
1179524362 21:41966062-41966084 GGCAACCTGCATGCCAGGGAAGG - Intergenic
1179595792 21:42442208-42442230 GGCCCCCTGTGTGCCAGGAAGGG - Intronic
1180655778 22:17419254-17419276 GGCCACCTGGCTGCGGATAATGG + Intronic
1181055185 22:20257514-20257536 GGCTACCTGCAAGCCAGGAAGGG + Intronic
950467938 3:13166505-13166527 GGCCACCTGGAAGCCAGTAAGGG - Intergenic
950681524 3:14588499-14588521 GGCCACCTGGGTCCCAGGAGAGG - Intergenic
950778525 3:15371535-15371557 GGCCATCTGCAAGCCAGGAAGGG - Intergenic
951093380 3:18600688-18600710 GGGCACCTGGATGTCAGTTAAGG - Intergenic
953808903 3:46095310-46095332 GGCCATCTGCAAGCCAGGAAGGG + Intergenic
954305371 3:49722749-49722771 GGTCACCTGAATGCAAGGAAGGG + Exonic
954417180 3:50399070-50399092 GGCCCCCTGCATGCCAGGAGGGG + Intronic
960352353 3:116608517-116608539 GGCCGCCTGCAAGCCAGGAAGGG + Intronic
961315819 3:126034971-126034993 GTGCTCCTGGATGCCAGTGATGG - Intronic
966774238 3:183529988-183530010 GGCCATCTGCAAGCCAGGAAGGG + Intronic
967396640 3:189016152-189016174 GGCCACATTGATGCCAGGGATGG - Intronic
968699628 4:2048367-2048389 GGCCACGTGGACGGCAGGAAGGG - Intergenic
968764969 4:2463348-2463370 AGCCACCTGGATGCCGGCAAAGG - Intronic
969079822 4:4609723-4609745 GGCCACCTGCAAGCCAGGAAGGG + Intergenic
974268352 4:59616250-59616272 GGCCACCTGTAGGGCAGTATTGG + Intergenic
979166248 4:117535091-117535113 AGACATCTGGATGCCAGCAAGGG + Intergenic
979251168 4:118567900-118567922 AGACATCTGGGTGCCAGTAAGGG - Intergenic
981409672 4:144414372-144414394 AGCCACATGGAATCCAGTAATGG - Intergenic
981568902 4:146131235-146131257 GGCCAGCTGAAGGCCAGTACAGG - Intergenic
982856616 4:160390411-160390433 GGCCATCGGGTTGCCAGTGATGG + Intergenic
986036225 5:3942899-3942921 AGCCACCTGGAAGCCAAGAAAGG + Intergenic
986053458 5:4112106-4112128 GGCCATCTGCAAGCCAGGAAGGG - Intergenic
986182794 5:5409216-5409238 GGCCACTTGCATGACAGGAATGG + Intergenic
986252611 5:6074451-6074473 GGCCACATTGTTGCCAGGAAAGG + Intergenic
987148615 5:15016975-15016997 GGACACCTGGGTGCCTGTGAAGG - Intergenic
987303681 5:16618204-16618226 GGCAGGCTGGTTGCCAGTAAAGG - Intergenic
988716021 5:33829146-33829168 GGCTACTTGCATGCCAATAATGG + Intronic
990266339 5:54080919-54080941 GGCCATCTGCATGCCAGGAGAGG - Intronic
999077767 5:148813120-148813142 GGCCACCTGCAACCCAGGAAGGG + Intergenic
1001825364 5:174740812-174740834 TGCCCCCTCGAGGCCAGTAATGG + Intergenic
1003018627 6:2490098-2490120 GGCCAACTGGGTTCCAGTTAGGG - Intergenic
1004536677 6:16509868-16509890 GGCCACCCGTATGCCTGTGATGG - Intronic
1005225005 6:23632417-23632439 GGCCACCTGGAGGTCATTTATGG - Intergenic
1006914239 6:37584542-37584564 GGGCACCTGGAGGCCAGGAGGGG - Intergenic
1022674078 7:32482087-32482109 GGCCACCTGGGTGCCAGTGAAGG + Intergenic
1029168263 7:98611980-98612002 GGCCCTCTGGTTTCCAGTAAGGG - Intergenic
1030444087 7:109626796-109626818 GGCCAATTGGAAGCCAGTCAAGG - Intergenic
1031885164 7:127238809-127238831 GGCCACCTGTATTCCAGCAGAGG + Intronic
1032796336 7:135279342-135279364 GGCCATCTGCAAGCCAGGAAAGG + Intergenic
1033664919 7:143431310-143431332 GGCCACCAGGAGGACTGTAAAGG - Intergenic
1037030029 8:14093248-14093270 GGCCACCAGGAGGCCAGATAGGG - Intronic
1037651674 8:20844627-20844649 GGCCACCTGGAAGATGGTAAAGG + Intergenic
1042566472 8:70117122-70117144 GGCCACCAGGATGCACGTGAAGG + Intronic
1045560529 8:103257599-103257621 GGCCACCTGGATGACAGGGAAGG - Intergenic
1045750768 8:105481387-105481409 GGCCATCTGCAAGCCAGGAAGGG - Intronic
1046637218 8:116683352-116683374 GGCCATCTGCAAGCCAGGAAGGG - Intronic
1047711792 8:127559762-127559784 GGCCACTTGGATGCCATTTTAGG + Intergenic
1048402134 8:134081997-134082019 GGCCATCTGTAGGCCAGGAAGGG - Intergenic
1049480876 8:142821966-142821988 GGCCCTGTGGATGCCAGTCAAGG - Intergenic
1050949201 9:11566744-11566766 GGACTCCTGGATGGCATTAATGG - Intergenic
1056753508 9:89368206-89368228 GGCCACCTGGATGTGAGTTTGGG - Intronic
1058648989 9:107157426-107157448 TTCCACCTGGATTCCAGCAATGG + Intergenic
1059496997 9:114718260-114718282 GGCCATCTGCAAGCCAGGAAGGG + Intergenic
1060283731 9:122230376-122230398 GTGTACCTTGATGCCAGTAAAGG - Intergenic
1060389627 9:123267700-123267722 GGCCACCGGGACGCCCGTGAAGG - Intronic
1061488849 9:130934212-130934234 GGGCACATGGCTCCCAGTAAGGG + Intronic
1061681714 9:132245713-132245735 TGCCACATGGAAGCCAGTGATGG - Intergenic
1187073023 X:15907485-15907507 GGCCATCTGTAAGCCAGGAAGGG - Intergenic
1187397088 X:18928145-18928167 GTCCACCTGGAAGTCAGGAATGG + Intronic
1199433052 X:147782367-147782389 GGACATCTGGGTGCCAGTGAGGG + Intergenic
1199773331 X:150989252-150989274 GGTCTCCTGGATGCCAGTGAGGG + Exonic