ID: 1069640063

View in Genome Browser
Species Human (GRCh38)
Location 10:69949095-69949117
Sequence GCAGCTTGTCCTCTTCATGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069640056_1069640063 18 Left 1069640056 10:69949054-69949076 CCAATTGACTTATTCCCAAAGAG 0: 1
1: 0
2: 0
3: 9
4: 145
Right 1069640063 10:69949095-69949117 GCAGCTTGTCCTCTTCATGCCGG No data
1069640055_1069640063 28 Left 1069640055 10:69949044-69949066 CCATAAAGAGCCAATTGACTTAT 0: 1
1: 0
2: 1
3: 11
4: 175
Right 1069640063 10:69949095-69949117 GCAGCTTGTCCTCTTCATGCCGG No data
1069640058_1069640063 4 Left 1069640058 10:69949068-69949090 CCCAAAGAGCAGGTTTCCAACTC 0: 1
1: 0
2: 0
3: 22
4: 191
Right 1069640063 10:69949095-69949117 GCAGCTTGTCCTCTTCATGCCGG No data
1069640059_1069640063 3 Left 1069640059 10:69949069-69949091 CCAAAGAGCAGGTTTCCAACTCA 0: 1
1: 0
2: 1
3: 16
4: 218
Right 1069640063 10:69949095-69949117 GCAGCTTGTCCTCTTCATGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069640063 Original CRISPR GCAGCTTGTCCTCTTCATGC CGG Intronic
No off target data available for this crispr