ID: 1069644122

View in Genome Browser
Species Human (GRCh38)
Location 10:69979725-69979747
Sequence CAGTGTGTCCAGCTTGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069644122_1069644125 1 Left 1069644122 10:69979725-69979747 CCATCTTCAAGCTGGACACACTG No data
Right 1069644125 10:69979749-69979771 TAGAGTGCATCCTGCCCTAGGGG No data
1069644122_1069644124 0 Left 1069644122 10:69979725-69979747 CCATCTTCAAGCTGGACACACTG No data
Right 1069644124 10:69979748-69979770 CTAGAGTGCATCCTGCCCTAGGG No data
1069644122_1069644127 8 Left 1069644122 10:69979725-69979747 CCATCTTCAAGCTGGACACACTG No data
Right 1069644127 10:69979756-69979778 CATCCTGCCCTAGGGGCTGGTGG No data
1069644122_1069644123 -1 Left 1069644122 10:69979725-69979747 CCATCTTCAAGCTGGACACACTG No data
Right 1069644123 10:69979747-69979769 GCTAGAGTGCATCCTGCCCTAGG No data
1069644122_1069644126 5 Left 1069644122 10:69979725-69979747 CCATCTTCAAGCTGGACACACTG No data
Right 1069644126 10:69979753-69979775 GTGCATCCTGCCCTAGGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069644122 Original CRISPR CAGTGTGTCCAGCTTGAAGA TGG (reversed) Intergenic
No off target data available for this crispr