ID: 1069644594

View in Genome Browser
Species Human (GRCh38)
Location 10:69984205-69984227
Sequence CTGAATATACAAATCAAGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069644594_1069644596 26 Left 1069644594 10:69984205-69984227 CCTAACTTGATTTGTATATTCAG No data
Right 1069644596 10:69984254-69984276 TAGAAATTGTAGAAATTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069644594 Original CRISPR CTGAATATACAAATCAAGTT AGG (reversed) Intergenic
No off target data available for this crispr