ID: 1069644596

View in Genome Browser
Species Human (GRCh38)
Location 10:69984254-69984276
Sequence TAGAAATTGTAGAAATTGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069644594_1069644596 26 Left 1069644594 10:69984205-69984227 CCTAACTTGATTTGTATATTCAG No data
Right 1069644596 10:69984254-69984276 TAGAAATTGTAGAAATTGACAGG No data
1069644593_1069644596 27 Left 1069644593 10:69984204-69984226 CCCTAACTTGATTTGTATATTCA No data
Right 1069644596 10:69984254-69984276 TAGAAATTGTAGAAATTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069644596 Original CRISPR TAGAAATTGTAGAAATTGAC AGG Intergenic
No off target data available for this crispr