ID: 1069646898

View in Genome Browser
Species Human (GRCh38)
Location 10:70006636-70006658
Sequence AATGCCTACTGGATATTTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069646898_1069646905 -5 Left 1069646898 10:70006636-70006658 CCCCAAAATATCCAGTAGGCATT No data
Right 1069646905 10:70006654-70006676 GCATTGGTTGGAAAGTATATGGG No data
1069646898_1069646904 -6 Left 1069646898 10:70006636-70006658 CCCCAAAATATCCAGTAGGCATT No data
Right 1069646904 10:70006653-70006675 GGCATTGGTTGGAAAGTATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069646898 Original CRISPR AATGCCTACTGGATATTTTG GGG (reversed) Intergenic
No off target data available for this crispr